Answer:
Exons because they are coding sequences
Explanation:
The sections of DNA (or RNA) that code for proteins are called exons.
In a clinical situation where it is essential to control microbial growth that includes both mycobacteria and endospores, the chemical <span>agent that would be the most effective to guarantee the broadest disinfection are chlorines.
Chlorine (Cl) is a yellow-green gas often used for disinfection in its liquid form. </span>
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
Solid
Explanation:
A radio device is a solid type of matter.
- Matter is anything that has weight and occupies a space
- There are three main categories of matter which are solid, liquid and gas
- A solid state of matter is made up of substances with a definite volume and a fixed shape.
- A radio has a fixed shape. Most of the come in a solid cuboidal or cube shape
- The volume of this three dimensional body can be measured which connotes the space it occupies at any given time.
- The mass of the radio can be taken using a balance.
Answer:
atom, its the only thing that does not match with the others with are cell involved
Explanation:
