1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vesna [10]
2 years ago
5

What are fish in North Carolina a nutritious source of?

Biology
1 answer:
kozerog [31]2 years ago
6 0

Answer:

<h2>B</h2><h2><u><em>brainliest or NOOOOOOOOOOOOOOOOOOOOOB</em></u></h2>

Explanation:

Health and Safety — Seafood is a complete source of protein because it contains all of the essential amino acids for optimal health. A 3-ounce cooked

You might be interested in
Uh Oh!<br><br> Hold on, our servers are swamped. Wait for this question to fully load.
dolphi86 [110]

Answer:

LOL IKR

Explanation:

5 0
3 years ago
Read 2 more answers
The difference between the mean value of a trait in the entire population, and the mean value of the individuals that breed succ
AURORKA [14]

Answer:Quantitative Genetics

Explanation:Quantitative Genetics deals with genetics that shows continuous vary characters. Quantitative Genetics shows the continuous distribution on segregating generation.

8 0
4 years ago
SOMEONE HELP ME PLEASE!
tatyana61 [14]
Its so small can u make it bigger?
8 0
3 years ago
Each muscle fiber contains tiny threads called _____, which are made of myosin and actin.
Gwar [14]
Myofibrils are the building blocks or contractile unit of each muscle fiber. The tiniest functional unit of skeletal muscle, the sarcomere, is found in the myofibrils and is made up of protein filaments: actin (thin) and myosin (thick).
7 0
4 years ago
Read 2 more answers
SOMEONE PLEASE ANSWER THESE ASAP
d1i1m1o1n [39]
B, 4,2 and seven I hope this helps!!
3 0
3 years ago
Read 2 more answers
Other questions:
  • What advantage does nuclear power have over fossil fuels
    8·1 answer
  • A 16-year-old girl who has become sexually active asks the nurse, "what's the most effective way to prevent a pregnancy?" which
    8·1 answer
  • Which describes the relationship between a genotype, a phenotype, and an organism’s experiences?
    11·2 answers
  • What is the primary function of an operator in the regulation of transcription in bacteria?
    5·1 answer
  • The semifluid material that fills most of the cell outside the nucleus is called?​
    5·2 answers
  • Which molecule is most common in the human body?
    14·1 answer
  • the data collected over the years clearly confirm depletion of ozone in the stratosphere. what do scientists still need to learn
    14·2 answers
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Succulents survive in hot, dry places by storing water in their stems and/or leaves. What type of adaptation is this?
    14·1 answer
  • 1. Why should you study cell
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!