1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stellarik [79]
4 years ago
10

What organism is able to appear at any level in a food chain/web?why?

Biology
1 answer:
andrezito [222]4 years ago
6 0
Fungi because they can break down any dead orginisms and be eaten by other orginisms.
You might be interested in
Biologists think early eukaryotic cells might have had a nucleus that first
lianna [129]

<em>Answer:</em>

<em>C. when the cells engulfed smaller prokaryotic cells</em>

3 0
4 years ago
In coral reefs, clownfish live unharmed among the poisonous tentacles of sea anemones. The sea anemones protect the clownfish fr
slava [35]

Answer:

The sea anemone and the clownfish live together in a type of symbiotic relationship called mutualism, where both species benefit from the other. The sea anemone offers the clownfish protection and leftover food

The anemone's tentacles provide the clownfish with protection from predators, while the clownfish chase away butterfly fish that would eat the anemone. ... Sea anemones can do very little to control the flow of water across their bodies, and they rely on local currents to bring in oxygen and nutrients.Clownfish perform an elaborate dance with an anemone before taking up residence, gently touching its tentacles with different parts of their bodies until they are acclimated to their host. A layer of mucus on the clownfish's skin makes it immune to the fish-eating anemone's lethal sting.Instead, both species have evolved behaviors that help them avoid being eaten while they graze for benthic algae. Butterflyfish typically swim in pairs near a particular clump of coral. ... An anemone robbed of its clownfish guards will quickly fall prey to the voracious butterflyfish.

8 0
3 years ago
Which statement best describes cancer cells?
Anvisha [2.4K]
The answer is (They are not regulated by contact inhibition.) Contact inhibition is the inhibition or the stopping of the movement and division of cells from rapidly and uncontrollably dividing.
7 0
3 years ago
Read 2 more answers
How are photosynthesis and cellular respiration related
amm1812

Answer:

The correct answer is C

Explanation:

the equation for cellular respiration is the direct opposite of photosynthesis: Cellular Respiration: C6H12O6 + 6O2 → 6CO2 + 6H2O.

Photosyntheses: 6CO2 + 6H20 + (energy) → C6H12O6 + 6O2

6 0
3 years ago
Which of these is a protein?<br> A) table salt<br> B) sunflower oil<br> C) collagen
Serggg [28]
I think c but not sure
5 0
4 years ago
Read 2 more answers
Other questions:
  • Which statement about cellular respiration is true? It produces oxygen. It requires water. It is used by every living cell. It c
    14·2 answers
  • What is it called when the lifting and removing of loose material by wind
    12·1 answer
  • All varieties of the common aquarium fish known as guppies can breed with each
    5·1 answer
  • Why are organelles important?
    5·1 answer
  • Which form of government would have the MOST amount of citizen participation?
    10·2 answers
  • Sydney has been drinking during her pregnancy. By doing so, she is putting her baby at risk of a severe disorder called
    7·2 answers
  • If all cells in your body have the same DNA, how are they able to look so different and carry out different functions?
    13·1 answer
  • Need help will mark Brainliest
    13·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • !!WILL MARK BRAINIEST!!!<br> What are the the inputs and outputs of the reaction??<br> See picture:
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!