1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Harlamova29_29 [7]
4 years ago
14

Which electronmagnetic wave has more energy

Biology
1 answer:
slamgirl [31]4 years ago
7 0
The Electromagnetic spectrum<span> lists the most powerful EMR, </span>gamma<span> rays, to the least powerful EMR, radio waves. In addition, the highest energy waves (</span>gamma<span>, x-ray) have the shortest wavelengths. The lowest energy waves, radio waves, have longest wavelengths.</span>
You might be interested in
"The drug naloxone can be used to counter the effects" of a heroin overdose by binding to opioid receptors and preventing heroin
Verizon [17]

Answer:

Naloxone is an antagonist at opioid receptors and heroin is an agonist at opioid receptors

Explanation:

An agonist is a substance that binds to a receptor and causes a biological reaction. In this case, heroine binds to opioid receptors. An antagonist blocks the reaction from the agonist, impeding the receptor's activation. Agonists and antagonists work for specific receptors, and for an antagonist to block an agonist they must bind to the same receptor, like naloxone does with heroin. Giving an antagonist that binds to one receptor and and agonist that binds to a different one means that the antagonist will have no effect.

6 0
3 years ago
Can you help me with both
Ahat [919]
Decisions, studied I think
3 0
3 years ago
Read 2 more answers
How do mutations cause variation?
Fofino [41]

Answer:

Mutations can create entirely new alleles in a population which changes the allele frequencies of a gene pool.

5 0
3 years ago
How does oceanic crust move along mid ocean ridges
77julia77 [94]

Question: How does oceanic crust move along mid ocean ridges

Answer: Oceanic crust slowly moves away from mid-ocean ridges and sites of seafloor spreading

Explanation: as a result it becomes cooler, more dense, and more thick.

question answered by

(jacemorris04)

6 0
3 years ago
Read 2 more answers
Which of the following does not occur due to passive transport?
DIA [1.3K]
A I think I hope this helped
6 0
3 years ago
Other questions:
  • Which describes an interaction within the musculoskeletal system?
    11·2 answers
  • 1. Which of the following structures is most likely to be found in an autotrophic protist?
    15·2 answers
  • To restore soil’s fertility, a farmer might plant legumes as part of a soil conservation technique called nutrient depletion. tr
    5·2 answers
  • Most aquatic animals have _____ for breathing while most land-dwelling animals have _____. gills; lungs spiracles; lungs lungs;
    10·1 answer
  • What is another name for the circulatory system, which transports blood throughout the body?
    11·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Post your thoughts on whether or not genetically modifying embryos to produce designer babies is a good or bad idea.
    5·1 answer
  • Choose the statements that are TRUE about Surface Tension..
    8·1 answer
  • 2. Мынадай: «метр», «сантиметр», «миллиметр», «микрометр», «мик-
    11·1 answer
  • What temperatures are involved in the pcr cycle? what processes take place at each temperature?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!