1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
babymother [125]
3 years ago
13

As you are exposed to high amounts of CO over a period of time your available hemoglobin becomes unable to bind to O2 because it

is bound to CO explain what would happen to cellular respiration and what overall effect this would have on the organism
Biology
1 answer:
sattari [20]3 years ago
3 0

Answer:

high enough quantities of CO would cause Cell respiration to stop and eventually cause the organism to die

You might be interested in
An example of a biogeochemical cycle is the
aliya0001 [1]
Water cycle because water or a chemical element is continuously recycled in an ecosystem which is biogeochemical
8 0
3 years ago
The parents of a school-age child with asthma express concern about letting the child participate in sports. what should the nur
Sedaia [141]
Exercise can often trigger asthma so it's important to have an inhaler available. Although sports isn't always recommended for a child with asthma. 
3 0
3 years ago
Multiple Choice
kotykmax [81]

Answer:

true

Explanation:

it a must to published topic so dat people can help you

3 0
2 years ago
Greg is hooked up to an eeg and his brain is producing smooth waves at a rate of about 10 per second. greg is most likely:
kap26 [50]
<span>awake and relaxed with their eyes closed. The frequency of 10 Hz is right in the middle of the alpha band of 7.5 to 12.5 Hz. Alpha waves are generally detected if the subject is awake and relaxed with their eyes closed. They drop in amplitude when the subject opens their eyes.</span>
7 0
3 years ago
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
Other questions:
  • What contributes to water's unique properties as a universal solvent, temperature moderator, and cohesive behavior? Hydrogen is
    9·1 answer
  • What marks the boundary between the mesozoic and the cenozoic (called the k-t boundary)?
    14·1 answer
  • Monomers are made up of many polymer units. True or False
    12·1 answer
  • What is the best example of water regulating an organism’s body temperature?
    12·2 answers
  • Which will form an ionic bond?
    14·1 answer
  • Difference between rare animals and protected animals in not less than 4 points​
    7·1 answer
  • plant roots grow in the direction of gravity. They are also exhibiting hydrotropism,which is a response to (A) water (B)gravity
    14·2 answers
  • 4. Show the cross between a ggBb and a GGBb. You'll have to set this one up yourself:
    9·1 answer
  • Many organizations release indexes used to measure the development of the world's countries. As we learned in this lesson, these
    15·1 answer
  • Naaman immediately followed Elisha's instructions.<br><br> True<br> False
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!