1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Luden [163]
3 years ago
8

Elect the correct answer.

Biology
2 answers:
alukav5142 [94]3 years ago
8 0

She should take her books and go to a local library to study.

Answer:A

Amiraneli [1.4K]3 years ago
5 0

A is the answer cause she might get distracted while listening then go on her phone, b is a no because she probably won’t even study I mean go to a cafe WITH YOUR FRIENDS to “study” sureeeeeeee hon

You might be interested in
During a lytic infection, the host cell__.
wel
Lytic infection is a kind of infection, which results in the bursting of a cell. During the lytic cycle, the infected cell and its membrane is being destructed. Therefore, during a lytic infection, the host cell is destroyed when it burst. The word lysis means the disintegration of a cell by rupture.
3 0
3 years ago
Read 2 more answers
Identify the structures in the cell pictured on the
ikadub [295]

Explanation:

<h3>Answer:-</h3>
  • A part is Cell membrane.
  • B part is cytoplasm.
  • C part is Ribosomes
  • D part is DNA.

<h2>Know More:-</h2>
  • Cytoplasm is a jelly like fluid present in a cell.
  • It contains many cell organelles which are suspended throughout IT.
  • Full form of DNA is Deoxy Ribonucleic Acid.
  • Ribosomes help in protein formation and are granular structures.
  • Cell membrane is the outermost covering of animal cell .
  • It is made up of proteins and lipids.
8 0
3 years ago
Read 2 more answers
All living things need energy;it is requirement for life. In a a typical cell ATP, the hogh energy,is produced in the blank in t
Oduvanchick [21]

All living things need energy;it is requirement for life. In a a typical cell ATP, the hogh energy, is produced in the mitochondria in the presence of sugar(glucose and oxygen

7 0
3 years ago
6. How are nucleotides arranged?
SSSSS [86.1K]

Answer:

A,T,G,C

Explanation:

all nucleartide are made by sticking a phosphate group

4 0
3 years ago
For the first time in her life, Margaret has little sexual desire. She is not alarmed as this is common in others around her age
skelet666 [1.2K]

Answer:45-50

Explanation:because she is attaining menopause

8 0
3 years ago
Other questions:
  • What do all cells need in order to perform cellular respiration?
    8·2 answers
  • When a sudden change in the environment, such as a flood or fire, reduces the size of a population, the survivors' collective ge
    10·1 answer
  • Consider this plant cell.
    11·2 answers
  • Read this passage:<br> BRUTUS: Who is here so base that would
    15·1 answer
  • genetics help: what is this person's ethnicity? Please provide facial features that made you think of that ethnic background
    12·1 answer
  • What does Tt mean to geneticists
    15·2 answers
  • GIVING BRAINLIEST TO FIRST GOOD ANSWER
    11·1 answer
  • What do cyclins regulate?
    7·2 answers
  • What did the experiments of Griffith and Avery show about genetic information ?
    10·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!