1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DochEvi [55]
3 years ago
10

Which form of selective breeding crosses parents with the same or similar sets of alleles? a. fertilization b. inbreeding c. hyb

ridization d. cloning
Biology
1 answer:
Travka [436]3 years ago
6 0
Inbreeding i believe..... you can have same set of alleles if related
You might be interested in
The fastest moving seismic wave
Andru [333]

Answer: the answer is A(Primary Waves)

Explanation:

p waves stand for primary waves. early seismologists called them that because the waves were the first to arrive at seismometers from some distant quake

Hope this helps plz give me an brainiest

4 0
2 years ago
_________ molecules don't have charged regions and are hydrophobic.
shusha [124]
_______ Lipid(fat)
Molecules don’t have charge regions in your hydrophobic
8 0
3 years ago
*16 points* (will mark brainiest) 9th grade Bio
Darya [45]
ATP
Carbon and Hydrogen
The speed up the rate of the reaction
During exercise when the need for energy is high
Cellular respiration? (Not sure)
DNA in the bacteria cell is always.......
7 0
3 years ago
Read 2 more answers
A client is suffering from scleroderma. which symptom might develop in the client on exposure to cold? raynaud’s phenomenon join
Leto [7]
Raynaud's phenomenon.
Scleroderma is a group of autoimmune diseases that may affect different parts of the body with special intensity in the skin. Some of the affected structures may be blood vessels. Because of this, when exposed to cold, vasoconstriction occurs and the Raynaud's phenomenon is manifested in the extremities of the body.
7 0
3 years ago
Which terms correctly identify the indicated structures in this
hammer [34]
I hope this picture helps you

8 0
3 years ago
Other questions:
  • We know that the atmosphere became more oxygen rich around 1.8 ga because of geologic evidence such as:
    10·1 answer
  • In the developing fetus, the umbilical __________ carries blood rich in nutrients and oxygen to the fetus.
    11·1 answer
  • PKU (Phenylketonuria) is an autosomal recessive disease, in which the synthesis of amino acid Tyrosine from Phenylalanine is blo
    15·1 answer
  • When both alleles are expressed with blended result, it is known as:
    14·1 answer
  • What's does the cloaca leads on a frog ?
    7·1 answer
  • How should we allocate resources so that the whole human population can have enough resources to live
    15·1 answer
  • What are some of the interactions the muscular<br> systems has with other body systems?
    13·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • The process by which plants transfer water into the air.
    13·2 answers
  • Why children should not be forced to choose site in a divorce situation ​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!