1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vlabodo [156]
3 years ago
10

Denise was measuring the effect of temperature on the amount of dissolved oxygen that water can hold. She hypothesized that as w

ater temperature increases, the amount of oxygen that is dissolved in water increases. Her data are shown in the table below.
Water temperature (ºC)
Dissolved oxygen (mg/L)
5
12.5
10
11.0
15
10.2
20
9.1
25
8.3

Which conclusion did Denise most likely write in her lab report?
The data did not support the hypothesis because the amount of dissolved oxygen decreased as water temperature increased.
The data did not support the hypothesis because the amount of dissolved oxygen increased as water temperature increased.
The data supported the hypothesis because the amount of dissolved oxygen decreased as water temperature increased.
The data supported the hypothesis because the amount of dissolved oxygen increased as water temperature decreased.
Biology
2 answers:
ArbitrLikvidat [17]3 years ago
7 0
The data did not support the hypothesis because the amount of dissolved oxygen decreased as water temperature increased.
Agata [3.3K]3 years ago
4 0

Answer:

The correct statement is that the data did not support the hypothesis because the amount of dissolved oxygen decreased as water temperature increased.

Explanation:

According to the hypothesis done by Denise, the dissolved oxygen will increase with the increase in temperature. However, on the basis of the results it is clear that as the temperature got increased from 5 degrees C to 25 degrees C, the dissolved oxygen in milligrams per liter got decreased consistently over the five measurements done. Thus, the experimental data did not support the hypothesis done by Denise. Thus, the correct statement would be the first one.

You might be interested in
What are some human activities that change the environment?
Aleksandr-060686 [28]

Humans impact the physical environment in many ways: overpopulation, pollution, burning fossil fuels, and deforestation. Changes like these have triggered climate change, soil erosion, poor air quality, and undrinkable water

Other answers:

Overpopulation.

Pollution.

Global Warming.

Climate Change.

Genetic Modification.

Ocean Acidification.

Water Pollution.

Deforestation.

7 0
2 years ago
Read 2 more answers
pick one biotic factor and change it dramatically somehow. How will this change affect the aquarium?
Inga [223]
If you get rid of the plant then the fish will have nothing to eat.
6 0
3 years ago
What are the 5 functions of nematodes in the soil
11Alexandr11 [23.1K]

Nematodes are wormlike organisms which can be seen with naked eye, live in water-filled pore spaces in the soil. Nematodes are in large number in the upper soil layers where organic matter, plant roots, and other resources are most abundant.

The functions of nematodes:

  • Free-living nematodes decompose organic material into nutrients and cycled them in the soil by feeding on some bacteria and fungi.
  • Nematodes help in distributing bacteria and fungi through the soil and along roots by carrying live and dormant microbes.
  • They used as food for higher predators, soil microorthropodes.
  • They eat disease-causing organisms, thus suppress their growth.
  • They acts as potential bio- control agents.
5 0
3 years ago
Read 2 more answers
Carbon compound that stores and transmits genetic information is called ________
MaRussiya [10]
Nucleic acids would be the answer to your question
3 0
3 years ago
Can someone please help me with this :)
kirill [66]
It is a that is what I think
8 0
3 years ago
Read 2 more answers
Other questions:
  • The nurse is providing care to a child with kawasaki disease. what does the nurse include in the child's plan of care? select al
    6·2 answers
  • What is not a desirable blood lipid value
    15·1 answer
  • Ossification of the ends of long bones ________. Ossification of the ends of long bones ________. is produced by secondary ossif
    8·1 answer
  • What kind of bacteria grows in one hour, and how much per hour?
    15·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • If you cross a pea plant that is analogous for yellow seeds (YY) and a pea plant that is analogous for green seeds (yy), what pe
    7·1 answer
  • Imagine that you wish to compare two different diets that will be fed to tadpoles raised in a lab. One diet is a meat-based fish
    5·1 answer
  • What is a Respiration in plant<br>​
    13·2 answers
  • Different between GNP and GNI.​
    7·2 answers
  • Why is the making of metamorphic rock a chemical change? Explain your answer no using 9009le​
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!