1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vesna_86 [32]
3 years ago
5

What relationship exists between nutrients and biomolecules?

Biology
2 answers:
slavikrds [6]3 years ago
7 0

Answer:

hola :v

Explanation:

solo quiero puntos >:v

mina [271]3 years ago
7 0

Answer:

Explanation:

Biomolecule, also called biological molecule, any of numerous substances that are produced by cells and living organisms. Biomolecules have a wide range of sizes and structures and perform a vast array of functions. The four major types of biomolecules are carbohydrates, lipids, nucleic acids, and proteins.

Among biomolecules, nucleic acids, namely DNA and RNA, have the unique function of storing an organism’s genetic code—the sequence of nucleotides that determines the amino acid sequence of proteins, which are of critical importance to life on Earth. There are 20 different amino acids that can occur within a protein; the order in which they occur plays a fundamental role in determining protein structure and function. Proteins themselves are major structural elements of cells. They also serve as transporters, moving nutrients and other molecules in and out of cells, and as enzymes and catalysts for the vast majority of chemical reactions that take place in living organisms. Proteins also form antibodies and hormones, and they influence gene activity.

You might be interested in
Migration is always temporary true or false
yawa3891 [41]
Migratoin is not always temporary so the anser is false
4 0
3 years ago
Read 2 more answers
Where is having brightly colored feathers that attract mates most clearly an adaptation for a bird?
GREYUIT [131]
The correct answer would most likely be A
3 0
3 years ago
For my science fair project, Im doing "Which plant fertilizer works best?"
mart [117]
You could do regular daisies, or pet grass... It could be almost anything.
I hope this helps!<span />
7 0
3 years ago
The center of a tornado is characterized by its _____.
Verdich [7]

The answer is eye walk

4 0
3 years ago
Read 2 more answers
Suppose a mutation occurs in an individual animal. What do you think would happen if the mutation had these different effects on
Nady [450]

Answer:

For effect #1, the mutation will become more common (A). This is because with the organism having more children, the trait will be passed around much faster and will spread to surrounding groups of animals.

For effect #2, the mutation will become more common (A). This is because the disease will kill the animals who do not carry the gene leaving only the animals with the trait, making it much more common

For effet #3, the mutation will disappear (B). This is because the animal carrying the gene will slowly die off. After all,  they will not be able to reproduce and pass the gene to their children.

For effect #4, the mutation will remain at a low level (C). This happens because since it procures no change there will be no reason to transfer it so it will become a recessive trait in the animals.

Explanation:

Hope this helps. . . <3

3 0
2 years ago
Other questions:
  • Pleaseeee help!!!!!!!! I will mark you as brainlinest for correct answer!!!!!!!!!!
    12·2 answers
  • Compare and contrast the processes of mitosis and meiosis
    7·1 answer
  • You have noted an increase in cancer rates among a local harbor seal population. You also noted an increase in the release of to
    11·2 answers
  • The instructions for building proteins necessary for all life functions are coded within an organism's genetic code. The genetic
    8·1 answer
  • The nucleolus __________. the nucleolus __________. is the primary site of protein synthesis is a dark-staining spherical body f
    13·1 answer
  • Animals in the chaparral biome are not especially vulnerable to drought. True or false Im kind of guessing true but I want a sec
    5·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • 2. What molecules do cells need to function?
    12·1 answer
  • Eight bones make up the __________ , which encloses and protects the brain.
    5·1 answer
  • Which of the following is NOT a way that carbon is released into the atmosphere?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!