1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
soldi70 [24.7K]
3 years ago
12

The nematode cuticle contains _____. glucose skin cells chitin nerve cells

Biology
1 answer:
Bingel [31]3 years ago
4 0

Answer:

The nematode cuticle contains chitin.

Explanation:

In nematodes, the cuticle is the outermost layer of the tegument, immediately above the epidermis and secreted by it. It is a rigid, acellular formation (without cells), of complex structure and composed of chitin, among other substances. Its function is twofold; on the one hand it is a rigid protective and impermeable layer; secondly, it is the anchor point of the animal's muscles, so that it acts as an external skeleton (exoskeleton).

You might be interested in
Your small intestine can absorb ____ without their being further digested
Alekssandra [29.7K]
Nutrients

If that's not the answer maybe it can be amino-acids
7 0
4 years ago
Hurry
kobusy [5.1K]
Increased gill surface area has allowed the cichlids to better absorb the limited oxygen in the water.

I hope it help and if it did :))))))
7 0
3 years ago
Complete the following sentences to describe the stages of the lytic cycle of viruses. Then, place the stages in chronological o
ddd [48]

Answer:

1. During the__ Attachment ____stage, enzymes digest cell wall and membrane material so that the viral nucleic acids can enter into the host cell.

2. During the ___ Penetration __ stage, the capsid of virus combines with receptors on the host cell's plasma membrane.  

3. During the__ Biosynthesis ____stage, viral nucleic acids and capsid components are produced.

4. During the ___ Release __ stage, lysozyme enzyme is produced, is rupturing the cell membrane and releasing viral particles.  

5. During the___ Maturation ___stage, viral nucleic acids and capsid components are assembled to produce viral particles.

Explanation:

I have attached picture explanation whole lytic cycle.

6 0
3 years ago
Explain- Why are tobacco,alcohol and ultraviolet radiation listed as carcinogens in the table?
Sati [7]
They can cause changes in a certain cell that can cause the growth or death in a cell.
7 0
3 years ago
In the context of stress hormones and the brain, _____ has a profound effect on the hippocampus, a brain structure that plays a
tatiyna
The correct term to fill in the blank would be cortisol. In the context of stress hormones and the brain, cortisol has a profound effect on the hippocampus, a brain structure that plays a pivotal role in memory. Cortisol is classified as a steroid hormone which is produced by the adrenal gland. It is deemed as the stress hormone as it is released as a response to stress as part of the fight or flight process. From studies, cortisol was found to have effect on the hippocampus when present in high levels. It damage and kill the cells in that area of the brain. The hippocampus is the area of the brain that is responsible for the long term memory storage. So, when this part is damage then the storage for our memories would surely be affected.
3 0
4 years ago
Other questions:
  • Define hydroplaning and how drivers can prevent its occurance
    12·1 answer
  • A weakened immune system may be caused by what?
    6·2 answers
  • Which of the following helps identify leaves as monocot or dicot?
    15·2 answers
  • Ecology is the study of a) plants and animals b) organisms and their environment c) relationship between organisms and their env
    6·1 answer
  • Does glycolysis need atp
    9·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • a star's brightness if it were a standard distance from earth is its apparent brightness true or false
    13·2 answers
  • 1. When did stromatolites appear on Earth?<br> Archean<br> Hadean<br> Mesozoic<br> Proterozoic
    9·1 answer
  • Why is recombination important to evolution
    15·1 answer
  • Mendel found that yellow pea pod color (G) was dominant to green pea pod color (g), and that round seeds (W) were dominant to wr
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!