1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksi-84 [34.3K]
4 years ago
11

What type of mixture is maple syrup

Biology
1 answer:
Alexandra [31]4 years ago
6 0
Maple Syrup Is A Solution.
You might be interested in
PLEASE HELP ME WITH SCIENCE WILL MARK BRAINLIEST!
MAVERICK [17]

Answer:

1 Photosynthesis uses CO2 and expels O2 and the reverse for respiration

2. stratosphere where ~90% of it is

3. Less infrared radiation is able to escape from the earth into space and that infrared radiation hits the GHG gases and the radiation is turned into kinetic or heat energy trapping which warms up the earth

Explanation:

8 0
3 years ago
Read 2 more answers
What activites are coordinated by cerebellum
Aleks [24]

This part of the brain is responsible for coordinating voluntary movements. It is also responsible for a number of functions including motor skills such as balance, coordination, and posture.

7 0
3 years ago
Organ of sweat is called
DiKsa [7]
Precipitation is your answer hope this helps pls thank me
3 0
4 years ago
Read 2 more answers
What molecule is represented by the molecular model shown below?
kow [346]

Answer:

what does the molecule look like??? i can't answer if i cannot see it

Explanation:

5 0
3 years ago
The Peterson family has three boys. If Mrs. Peterson is pregnant with her fourth child, what is the probability that this child
lesya [120]
1/4 25 percent.. . .
5 0
4 years ago
Read 2 more answers
Other questions:
  • Ligation reactions occur most efficiently between DNA fragments:
    5·1 answer
  • Which of the following is true about natural selection?
    9·1 answer
  • Which part of the DNA molecule codes for the amino acid sequence in theprotein
    12·1 answer
  • The somatosensory cortex is responsible for processing ________.
    5·1 answer
  • A test is available to diagnose a disease. if a person has the disease, the probability that the test will produce a positive si
    10·1 answer
  • Analyze and evaluate how natural selection produces change in populations as opposed to individuals.​
    8·1 answer
  • Meiosis is important for sexual reproduction because it gives sex cells (gametes) what unique feature?
    10·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Which group of bacteria is most likely responsible for stew fish spoilage in Anastacia's refrigerator cooler?
    14·1 answer
  • digestive enzymes released in your mouth break down carbohydrates there but stop working in your stomach. which is the most like
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!