1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
djyliett [7]
2 years ago
10

What type of symmetry does an organism have if it has five identical parts extending from a central hub? A. bi-radial symmetry B

. mirrored symmetry C. penta-radial symmetry D. tubed symmetry
Biology
1 answer:
lapo4ka [179]2 years ago
4 0
Pretty sure it <span>C) penta-radial symmetry.</span>
You might be interested in
choose the animal belonging to pisces group: silver fish, sea horse,dolphin, lobster. answer asap! thx​
mihalych1998 [28]

Answer:

The correct answer is

Explanation:

Lobster is the answer. People eat lobster in pieces which we call as lobster piece.

Hope this helps....

Have a nice day!!!!

8 0
3 years ago
Which of the following would disappear first in an estuary was destroyed?
Eduardwww [97]

a-shellfish is your answer

6 0
3 years ago
Parasitism describes a relationship between two organisms where: *<br> 1 point
abruzzese [7]

Answer:

Parasitism describes a relationship between two organisms where one gets benefit and other get harm.

Explanation:

Parasitism is a type of symbiotic association that is present between two different organisms. In association, one organism gets benefit from the other and the other is damaged. For example, association between mosquitoes and human is parasitism because mosquitoes get benefit in the form of food while human is damaged due to disease cause by mosquito biting.

4 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
This is so difficult pls help
lapo4ka [179]

Answer:

<em>B</em><em>.</em><em> </em><em>I</em><em>t</em><em> </em><em>i</em><em>s</em><em> </em><em>g</em><em>o</em><em>o</em><em>d</em><em> </em><em>s</em><em>o</em><em>l</em><em>u</em><em>t</em><em>i</em><em>o</em><em>n</em><em> </em><em>b</em><em>e</em><em>c</em><em>a</em><em>u</em><em>s</em><em>e</em><em> </em><em>p</em><em>e</em><em>o</em><em>p</em><em>l</em><em>e</em><em> </em><em>w</em><em>i</em><em>l</em><em>l</em><em> </em><em>h</em><em>a</em><em>v</em><em>e</em><em> </em><em>s</em><em>a</em><em>n</em><em>d</em><em> </em><em>t</em><em>o</em><em> </em><em>w</em><em>a</em><em>l</em><em>k</em><em> </em><em>o</em><em>n</em><em> </em><em>a</em><em>l</em><em>o</em><em>n</em><em>g</em><em> </em><em>t</em><em>h</em><em>e</em><em> </em><em>b</em><em>e</em><em>a</em><em>c</em><em>h</em><em>.</em>

8 0
2 years ago
Other questions:
  • In contrast to bioremediation, which is a strategy for _____, biological augmentation _____ a degraded ecosystem.
    9·1 answer
  • A 45 yr old female presents with abdominal guarding and ridgidity. the upright x ray is attached. what does "a" indicate virgini
    7·1 answer
  • True or false: If a product has no added sugar, it is also sugar-free.
    15·2 answers
  • Which of the following is true regarding the structure of enzymes?
    5·1 answer
  • What is the basic cause of ocean tides? A. Gravitational attraction between the Moon and the entire solar system B. Gravitationa
    6·2 answers
  • Does Chlorine by gaining an electron becomes chorine ion with a symbol Cl​
    9·1 answer
  • When the land or oceans are heated unevenly,
    5·2 answers
  • What is an example of a codominate<br> phenotype?
    14·1 answer
  • Each new cell formed after cytokinesis"
    5·2 answers
  • In a separate location, take notes from the sources you have identified. The notes will provide details for your presentation. W
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!