1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ivan
3 years ago
14

PLEASE HELP! Name one characteristic that all protists have in common that separates them from monerans.

Biology
2 answers:
Katen [24]3 years ago
6 0
They all have two general types of organisms... protozoa and algae.

They can usually move themselves and capture prey.

The most plantlike Protists are called algae (usually unable to move themselves).

They are very small.

They can cause harmful events and diseases (Malaria and African sleeping sickness).
disa [49]3 years ago
6 0

They are eukaryotic, whereas monerans are prokaryotic.

You might be interested in
The process of obtaining food is known as _________ and requires specialized feeding mechanisms. A. ingestion B. digestion C. ab
Svetllana [295]

Answer: A

Explanation:

8 0
2 years ago
What happens when previous adaptations are no longer suitable for changes in the environment
castortr0y [4]
That is when extinction occurs. Hope I helped!
6 0
3 years ago
what is the function of vesicles in the synthesis of proteins and the release or those proteins outside the cell?
Zina [86]

Vesicles transport newly synthesized proteins to the Golgi apparatus. After the Golgi apparatus modifies the proteins, vesicles transport the modified proteins to the cell membrane, where they are released.

Hope this helps!

-Payshence

7 0
3 years ago
In what century is the cellular theory<br><br><br> En que siglo se planteó la teoría celular
Pepsi [2]
Cell theory was fdiscovered in the 17th century. but the first. cell theory was credited in the 19th century.
8 0
3 years ago
What are the three amphipathic lipids are present in the cell membrane?
Akimi4 [234]

phospholipids, glycolipids, and sterols

3 0
3 years ago
Read 2 more answers
Other questions:
  • Choose the phase of the bacterial growth curve during which a bacterial population has the briefest doubling time.
    9·1 answer
  • How does the pattern of embryological development provide further evidence that organisms have descended from a common ancestor?
    11·2 answers
  • Why are both tigers and humans classified into the Animalia kingdom within the Eukaryota domain?
    10·2 answers
  • The Sponge Is A _ Animal Because It Has More Than One Cell
    14·2 answers
  • Which Indian helped Roland Ross in his research for Malaria by finding Mosquitos?
    13·1 answer
  • Compare bacteria to other single-celled organisms. How do they differ? How do they compare to viruses?
    6·1 answer
  • Energy is stored in the ____________________ (chemical bonds, sugars).
    8·2 answers
  • The earth's magnetic field is associated with the:
    12·1 answer
  • What land plants produce most of the world's oxygen? Please help fast
    10·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!