27
In a normal double strand DNA, adenine (A) on one strand only pair with thymine (T) on the other strand because the two syrands are complementary.
One function that determines when and if cell division takes place is the activation of growth hormones.
The act of controlling body temperature is called thermoregulation. For example, a lizard can raise its body temperature by going in the sun, and cool it down by going under a rock
Thymine(T) pairs with adenine(A)
Adenine(A) pairs with uracil(U)
Cytosine(C) pairs with guanine(G)
therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT
is
AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA
Well, it depends on the conditions on the planet/moon. Does it have water? Soil for crops? Oxygen? Poisonous air? Is the temperature incredibly high, or low? The necessary equipment for survival on the planet/moon depends on what's needed.
