1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mel-nik [20]
3 years ago
10

If blood flukes were to exhibit strict cophyly over millions of years, you would predict that blood flukes would:

Biology
2 answers:
babymother [125]3 years ago
6 0

Cophyly is the process when a parasite and host speciate together.

If blood flukes were to exhibit strict cophyly over millions of years, you would predict that blood flukes would- evolve in a manner that is exactly in the same way as the evolution of their host. Evolution is a process when something evolves over a period of time.

mr_godi [17]3 years ago
4 0

Answer:

Cophyly is the process when a parasite and host speciate together.

If blood flukes were to exhibit strict cophyly over millions of years, you would predict that blood flukes would- evolve in a manner that is exactly in the same way as the evolution of their host. Evolution is a process when something evolves over a period of time.

Explanation:

Read more on Brainly.com - brainly.com/question/12085602#readmore

You might be interested in
In which kingdoms are all organisms multicellular?
Ede4ka [16]
B. Animalia and Plantae, or animals and plants, are multicellular organisms.
4 0
3 years ago
Read 2 more answers
Scenario:
Alex777 [14]

Answer:

symbiotic

Explanation:

symbiotic relationships benefit both organisms

8 0
2 years ago
Which statements describe the effects of the solar wind on Earth? Check all that apply. The solar wind produces the northern and
Andrei [34K]

The correct answers are:

• The solar wind produces the northern and southern lights

• The solar wind disrupts communication systems.  

• The solar wind distorts Earth's magnetic field.

Solar winds are geomagnetic stream of charged particles radiated from the outer atmosphere of the sun. All planets are protected from solar winds via magnetic fields but planets that are positioned closer to the sun can experience degeneration of the magnetic field.

Solar winds are capable to distort and even destroy the functioning of communication satellites  in outer space, such as radio and tv communication and satellite based internet services.

The effects of solar winds that are visible to naked eye are the Aurora Borealis (the Northern lights) and the Aurora Australis (the Southern Lights).


7 0
3 years ago
Read 2 more answers
A student wants to know which part of his local beach contains the most turtle nests during nesting season. He researches turtle
VladimirAG [237]
CONSTRUCTION OF HYPOTHESIS is missing from the experiment. The correct option is B. 
A scientific hypothesis is a foundation that must be well laid in any scientific experimental research. A research hypothesis refers to statements made by a researcher which defines his speculations on the outcomes of the research, it is an educated guess that is based on prior knowledge and observations.
5 0
3 years ago
Read 2 more answers
Why does the altitude decrease in the troposphere?
vichka [17]
Altitude decreases the temperature in the troposphere....
8 0
3 years ago
Other questions:
  • A book that weighs 0.35 kilograms is kept on a shelf that’s 2.0 meters above the ground. A picture frame that weighs 0.5 kilogra
    12·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • 3. How do osteoclasts break down the bone?
    6·1 answer
  • Scientists observed that over the past 40 years, marmots are located at increasing elevations on mountains. What is the best exp
    14·1 answer
  • William wanted to create a report on a geographical location with the greatest species diversity. Which ecosystem can consider f
    7·2 answers
  • The capsid of a virus is the
    15·2 answers
  • If the plasma membrane was permeable, but not selectively permeable, how would that affect the cell?
    7·1 answer
  • Which of the following is an accurate description of a positive feedback loop? SC.912.E.7.7
    8·1 answer
  • What happens during cytokinesis?
    6·1 answer
  • Mutation spectrum analysis of Duchenne/Becker muscular dystrophy in 68 families in Kuwait: The era of personalized medicine
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!