1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
damaskus [11]
3 years ago
8

Fill in the blank.

Biology
2 answers:
Inessa [10]3 years ago
8 0
The answer tot his question is:

<span>Fill in the blank. 
</span>A scientific ___________ is a proposed explanation that can be tested."<span>Scientific Theory."

Hoped This helped, </span><span> Jaylamariejohsov5zsb
Your Welcome:) </span>
torisob [31]3 years ago
8 0
<span>Theory................................................</span>
You might be interested in
The _____ system is a communication network closely linked to the nervous system.
choli [55]
The answer is endocrine system. It includes all of the glands of the body and the hormones produced by those glands. The glands are controlled directly by stimulus from the nervous system as well as by chemical receptors in the blood and hormones produced by other glands. By regulating the roles of the organs in the body, these glands help to continue the body’s homeostasis. Cellular metabolism, reproduction, sexual development, sugar and mineral homeostasis, heart rate, and digestion are amid the several processes controlled by the actions of hormones.
4 0
3 years ago
Which system sends messages to organs and tissues? asnwers.com?
muminat
Neurological - by nerves
Endocrinological - by blood and secrets
6 0
3 years ago
During the human digestion process, digestion is compartmentalized in various organs throughout the digestive system. how does t
GenaCL600 [577]

The human digestion starts in the small intestine gets the most of the nutrients in your food, and your circulatory system passes them on to other parts of your body to store or use.  When food enters the small intestine, villi along the intestine wall along with enzymes help break down the food, and takes a long journey. The stomach is right above the small intestine, and the small intestine is all wrapped around, and isn't that thick. Nutrients from the food are released to the whole body as energy. The small intestine brings the food to the large intestine, which is five feet long and is near your pelvis, or hips. The large intestine connects to the rectum, and then to the anus. In the large intestine, all the water is absorbed as well as salt.

8 0
3 years ago
Which one of the following organs secrets enzymes that affect the digestion and absorption of nutrients in the small intestine?
Sveta_85 [38]

Answer:

Pancreas

Explanation:

It is the main organ that regulates nutrients and sugar flow in the blood. That is why diabetes and other diseases most commonly occur in the pancreas.

7 0
3 years ago
Read 2 more answers
What is the main term used to locate COPD in the alphabetic index
vaieri [72.5K]

Answer:

Chronic obstructive pulmonary disease

Explanation:

I'm not 100%  sure of what you're asking here but the main term for COPD is Chronic obstructive pulmonary disease. COPD is a long-term lung disease, which makes breathing especially difficult. I hope this helps:)

7 0
3 years ago
Other questions:
  • Which of the following is a reservoir for carbon and nitrogen, but not phosphorus? land ocean atmosphere
    12·2 answers
  • What is salivary gland? tell its functions.
    13·2 answers
  • A(n) _____ includes all living and nonliving things in an environment.
    9·1 answer
  • What would you expect ir spectrum of 1,1'- diacetylferrocene to look like?
    6·1 answer
  • After Darwin proposed his ideas about natural selection as a mechanism for evolution was generally considered a theory. Why do w
    12·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Which neuron delivers information to the central nervous system​
    12·2 answers
  • The process by which an organism makes more of its own kind is
    13·2 answers
  • Any GUY wanna talk, im a girl whos 17 and who loves to work on cars and play in the woods
    5·1 answer
  • What’s an adaptation we could not live with out ?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!