1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sasho [114]
3 years ago
14

Some protists swim using _____, numerous short hair-like projections

Biology
1 answer:
nata0808 [166]3 years ago
7 0
This would be flagella
You might be interested in
If a phlebotomist is collecting blood specimens from a patient in the nuclear medicine department, he or she needs to be:
klio [65]
<span>The person needs to be wearing a dosimeter badge. This is used as a way of measuring the overall radiation that has collected upon the person in the nuclear environment. While the badge does not actually protect against the radiation, it does give the wearer information about whether or not they are in a potentially unsafe situation.</span>
4 0
3 years ago
The ability of a person's cardiovascular system to compensate for blood loss is most related to?
amid [387]

The ability of a person's cardiovascular system to compensate for blood loss is most related to how rapidly he or she bleeds.

<h3>what is cardiovascular system made up of?</h3>

Your cardiovascular system, which consists of your heart and blood arteries, is an essential component of your body. When your cardiovascular system is functioning properly, your cells receive a constant supply of oxygen and nutrients from your blood. Carbon dioxide and other waste are also removed via blood vessels. You have the ability to maintain your heart and blood vessels healthy. Eating healthy foods, exercising, keeping your blood pressure and cholesterol under control, and quitting smoking are all beneficial to your cardiovascular system. Request assistance from your provider in achieving heart health.

<h3></h3>

learn more about cardiovascular system refer:

brainly.com/question/946975

#SPJ4

7 0
2 years ago
The hypothetical island country of Gilder lies in the Mediterranean Sea off the coast of
Dahasolnce [82]

Answer:

Population (No) Population (Nt)

20,000,000 20,820,000

20,820,000 22,000,000

22,000,000 23,735,000

23,735,000 25,843,000

25,843,000 28,183,000

Explanation:

The change in Gilders population could include factors like prosperous economy and improved healthcare. This is due to the fact that as the birth rates increase the death rates decrease. Improved healthcare has slowed down the death rate. Secondly, the prosperous economy contributes to amount of immigrants coming in and out of this country.

3 0
3 years ago
Read 2 more answers
How do you think the cell theory impacted later scientific discoveries?
olchik [2.2K]
The cell theory of course had an important impact on later scientific discoveries as many different hypothesis and scientific discoveries were derived and concluded with the help of basics from this theory.
3 0
3 years ago
As scientists advise about potential risks due to climate change, species loss is a high ranking ecological concern. One group o
Elena L [17]

Answer:

B

Explanation:

USA Test Prep said so.

3 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Why is it important to balance majority rule with minority rights
    7·1 answer
  • The sequence of subunits in a protein is most directly dependent on the
    7·1 answer
  • The various parts of the endomembrane system serve different functions in the cell. In this activity, you will identify the role
    10·1 answer
  • What is osmosis? in your own words
    15·2 answers
  • I need help asap
    7·1 answer
  • The modern synthesis brought together Darwin's theory of evolution with Mendelian genetics. Why was this so important?
    11·1 answer
  • How does bacteria reproduce?
    5·2 answers
  • Each Taxonomy (category) gets less and less specific as they go further down the list.
    12·2 answers
  • As women age, many experience an increased sense of urgency to void, as well as an increased risk of incontinence. this is usual
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!