1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jok3333 [9.3K]
3 years ago
7

A person is swimming when a fish touches his foot. his heartbeat and breathing increase for a few seconds until he realizes the

fish is harmless. which part of the nervous system returns his heartbeat to norma
Biology
1 answer:
UkoKoshka [18]3 years ago
4 0
Parasympathetic will return her heartbeat back to normal. This nervous system is responsible for regulating the body's unconscious actions, and stabilizes it.
You might be interested in
Which list shows stars in order of increasing temperature?
gtnhenbr [62]
Remember, the cooler stars are white or yellow like the sun, and hottest are blue. Based on that, it should be in this order: Barnard's Star, Polaris, Sirius, and Rigel.
5 0
3 years ago
Please help me with this question :)
77julia77 [94]

Answer:

option C

option C

Explanation:

we know that gravity is strongest when two large objects are near each other--so, when the asteroid reaches point C (which is shown to be closest to the sun), the pull of gravity will be greatest.

We also know that the attraction/pull of gravity slows down objects, so, the asteroid will be going slowest at its point of strongest gravity--which we have determined to be point C

hope this helps! let me know if you need more explanation, have a lovely day :)

8 0
2 years ago
Read 2 more answers
Transport channels are made of what molecules?
Sauron [17]

Answer:

Proteins.

Explanation:

They are called membrane proteins.

8 0
3 years ago
Name the form of polymers derived from petroleum
LUCKY_DIMON [66]
I think the polymers are the hydrocarbons.

If this helped please mark me as brainliest.
6 0
3 years ago
40. Invasive species
Airida [17]
That would be C.

Invasive species are brought to a new area by human activities.
3 0
3 years ago
Other questions:
  • At the end of meiosis 2, each of the haploid sex cells has only half the number of chromosomes as the original diploid cell. Why
    8·1 answer
  • Help me please!!!<br> identify two uses of nonrenewable resources shown in the picture
    7·1 answer
  • You are a pelican searching for fish in the ocean from high in the sky. although you see no tasty fish in the open ocean, you so
    11·1 answer
  • Which paragraph describes the correct procedure for preparing a stained wet mount of onion epidermis?
    6·1 answer
  • Which one of the following steps would be included in the primary response in humoral immunity?
    15·1 answer
  • What causes variations in asexual organisms?
    6·1 answer
  • Which type of microscope can produce three-dimensional images of a cell’s surface?
    8·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • If a DNA codon changes from TTA to TTC, what amino acid would the matching mRNA sequence code for?
    10·1 answer
  • How do energy and matter move in ecosystems?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!