1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mr Goodwill [35]
4 years ago
15

What is the process of cell division called?

Biology
1 answer:
lbvjy [14]4 years ago
8 0
It's mitosis. When a cell is large enough, it will split into two different cells asexually.

Hope this helped!! :D
You might be interested in
Which does not occur during translation?
vazorg [7]

Answer:

The transcription of DNA into a complementary strand of mRNA does not take place in translation.  

Explanation:

6 0
4 years ago
Read 2 more answers
Which of the following would prevent an organism from becoming part of the fossil record when it dies?
stepan [7]

Answer: Option D

Explanation:

A fossil can be defined as the imprint or plant or animal that is preserved in the environment which can be used to known the organism or environment at that time.

The fossil formation takes place when the organism is trapped in ice, trapped in sap or it gets buried in fine sediments at the bottom of the lake.

In these cases the animals dies and remains as it is to form fossil but if incase the animals is completely decomposed by the bacteria and fungi then it cannot be transformed into a fossil as there will be no remains left.

The correct answer is option D

4 0
3 years ago
Describe the importance of the cell membrane containing both polar and non polar parts
vaieri [72.5K]

The main component of the cell membrane is a phospholipid bi-layer or sandwich. The heads (the phospho part) are polar while the tails (the lipid part) are non-polar.

6 0
3 years ago
If a male genotype is Tt and the female genotype is TT, then what are the phenotypic ratios for tall and short corn?
Helen [10]

The correct answers are: All Tall, 1:1

4 0
3 years ago
ANSWER ASAP: Dead zones are caused largely by the input of agricultural fertilizers that stimulate phytoplankton blooms, which d
d1i1m1o1n [39]

Answer:

Less oxygen dissolved in the water is often referred to as a “dead zone” because most marine life either dies, or, if they are mobile such as fish, leave the area. Habitats that would normally be teeming with life become, essentially, biological deserts.

Hypoxic zones can occur naturally, but scientists are concerned about the areas created or enhanced by human activity. There are many physical, chemical, and biological factors that combine to create dead zones, but nutrient pollution is the primary cause of those zones created by humans. Excess nutrients that run off land or are piped as wastewater into rivers and coasts can stimulate an overgrowth of algae, which then sinks and decomposes in the water. The decomposition process consumes oxygen and depletes the supply available to healthy marine life.

Dead zones occur in coastal areas around the nation and in the Great Lakes — no part of the country or the world is immune. The second largest dead zone in the world is located in the U.S., in the northern Gulf of Mexico.

Explanation:

4 0
3 years ago
Other questions:
  • Microevolution _____.
    10·2 answers
  • Which describes the horizons in a soil profile? Horizon A is mineral deficient. Horizon O forms from organic material. Horizon B
    6·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Select all of the answers that apply.
    14·2 answers
  • Which layer of the alimentary canal is constructed from either stratified squamous or simple columnar epithelium?A) muscularis e
    5·1 answer
  • The 3'-5' exonuclease activity of DNA polymerase is critical for:
    12·2 answers
  • I really gotta fart like super duper really bad biology stuff
    10·1 answer
  • What novel characteristics are shared by gymnosperms and angiosperms but not by mosses and ferns?
    6·1 answer
  • Why monosaccharides are sweet whereas polysaccharide are not​
    12·2 answers
  • Suppose that a person takes a fall while hiking and develops tetanus when the pathogen enters through an open wound in their arm
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!