1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lara31 [8.8K]
4 years ago
8

What is the minimum number of data points an experiment should gather?

Biology
1 answer:
NARA [144]4 years ago
4 0
Theater to your question is A
You might be interested in
You see a structural formula in which the symbols for elements are connected by a long dash. You can assume that the chemical bo
masha68 [24]

The correct answer is option B, that is, covalent bonds.  

Covalent bonds are more prevalent in organic chemistry in comparison to ionic bonds. A covalent bond comprises of the concurrent attraction of two nuclei for one or more electron pairs. The electrons situated between the two nuclei are known as bonding electrons.  

Covalent bonds take place between different atoms or similar atoms whose difference in electronegativity is not enough to permit the transfer of electrons to produce ions. The covalent bond is demonstrated by either as a solid line or long dash or as a pair of dots.  


5 0
4 years ago
Sarah is documenting her sources. Which step of research process is she on? A. Step 5: Cite Your Sources B. Step 4: Organize You
Anestetic [448]

Answer:

Either A or B

Explanation:

8 0
3 years ago
Read 2 more answers
Does cellular respiration result in a net input of energy or a net output of energy?
otez555 [7]

Answer:

Cellular respiration results in net output of energy.

Explanation:

Cellular respiration can be described as a process in which cells convert glucose and oxygen into carbon dioxide and water. Energy is released in the form of ATP in the process hence, it gives a net output of energy.

As a result of cellular respiration, two molecules of energy (ATP) are produced in glycolysis, Kreb's cycle also produces 2 molecules of ATP, 34 molecules of energy (ATP) are produced by the electron transport chain

3 0
3 years ago
1. What are the Galapagos Islands?
ki77a [65]

Answer: there are islands

Explanation:

3 0
3 years ago
Read 2 more answers
You have been given a single virgin Drosophila female. You notice that the bristles on her thorax are much shorter than normal.
eimsori [14]

Answer:

B

Explanation:

We never see short bristle males, suggesting some type of lethality. I.e. any males who inherit the mutation die before birth so we don't see the phenotype. This also hints that it could be X-linked.

Females can be short bristled, but males can't, as it is likely lethal. This suggests that having one copy of the short bristle trait without the long bristle trait is lethal (as males as XY and so only have one copy of the trait). The female then must be heterozygous for the short bristle trait (which also explains how in generation F2, long bristle males can be produced, as if she was homozygous males would all be short bristled, and therefore dead, so there would be no males.

Since the first short bristle female is heterozygous, the trait for short bristles must be dominant.

However, since evidence suggests the trait is X-linked, it cannot be autosomal, as suggested in B.

8 0
3 years ago
Other questions:
  • The largest level of organization in living things is a(n) (2 points)
    11·1 answer
  • The body is composed of microscopic cells that are visible if viewed under a ____
    8·2 answers
  • In glacial erosion by abrasion, a glacier _____.
    6·2 answers
  • What is physical science
    12·2 answers
  • HELP PLSSSSS what is the scientific process described detailed.
    15·2 answers
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • How are meiosis and mitosis different?
    15·2 answers
  • Which of the following occurs during mitosis but
    10·1 answer
  • What produced the elements heavier than iron (Fe)?
    9·2 answers
  • How can a particular trait be both advantageou and disadvantageous?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!