1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VikaD [51]
3 years ago
12

Matt intends to throw a rock at jamal and hit jamal in the head. jamal is standing directly next to sally. matt hits sally in th

e head instead of jamal. what type of tort did matt commit against sally
Biology
1 answer:
katen-ka-za [31]3 years ago
6 0
Answer:

The options for this question are:

1. A negligent tort because Matt was careless in throwing the rock.
2. A negligent tort because he only intended to harm Jamal.
3. An accidental tort because he struck Sally by mistake.
4. An intentional tort because Matt intended to throw the rock and physical injury resulted.
5. Matt did not commit a tort against Sally because he only intended to strike Jamal with the rock

The best answer choice is:

An intentional tort because Matt intended to throw the rock and physical injury resulted.

Explanation:
If Matt originally wanted to hit Jamal with a rock in the head but instead hit Sally who is standing directly next to Jamal, then he committed an intentional tort. This kind of tort can be transferred as the tort easer knew certainly that his plan would result in inevitable consequences.<span>
</span>
You might be interested in
Costa Rica, located in Central America, features a very high level of biodiversity due to its tropical climate and large range o
maxonik [38]

Answer:

The interaction between the sloths and the leaves they eat is an example of a<u> predator-prey</u> relationship. In this example, sloths are <u>herbivores</u> that acquire their nutrients and energy from the<u> plants</u> they eat. The colors of coral snakes provide these animals with <u>mimicry</u> to avoid predation. Specifically, their coloration helps them <u>advertise their toxicity.</u> The interaction between the hosts and the ticks that live on them can be characterized as <u>parasitism</u>, because <u>one species feeds on the other</u>.

Explanation:

Predator-prey relationships are those in which a specie feeds on another specie. The sloth is the predator that feeds on the leaves which are its prey. Herbivores feed on plants. Therefore, the sloth are rightly classified as herbivores.

Coral snakes are brightly colored with red, yellow, and black patches that warn potential predators of their toxicity. Ticks living on hosts are parasitic because the ticks feed on their host.

8 0
2 years ago
A friend has a misconception that fungi are really "no different from plants except for how they look." What might you say to he
goldenfox [79]
Fungi contain many different microscopic organisms compared to regular plants, Fungi can be very poisonous compared to plant too and also a regular plant contains a cell wall where as Fungi don't. Most importantly plants use the process photosynthesis to make their own food, Fungi don't.
7 0
3 years ago
Hayvan hücrelerinde iğ ipliklerini hangi organel oluşturur?​
m_a_m_a [10]
I don’t know Turkish
8 0
2 years ago
Please answer this i'll give you brainliest
Rainbow [258]

Answer:

sorry if my answer is incoplete.

5 0
2 years ago
Read 2 more answers
Humans have how many pairs of chromosomes
pashok25 [27]
23 chromosomes is the amount of pairs
3 0
2 years ago
Other questions:
  • Match the following. 1. coyotes omnivores 2. cattle scavengers 3. alligators herbivores 4. vultures carnivores
    10·2 answers
  • Which molecule shown above contains a functional group that is a part of the molecule known as the "energy currency of living or
    6·1 answer
  • All changes saved
    12·1 answer
  • What is the casparian strip? why is it important?
    8·1 answer
  • The source of all food energy is the ocean.<br><br> True<br> False
    15·1 answer
  • Select all that apply
    15·2 answers
  • Please answer fast I'll mark brainliest
    11·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • a white radish has the genotype WW. A purple radish represents tbe heterozygous-RW.If two purple radishes are crossed what is th
    13·1 answer
  • Which of the various species concepts distinguishes two species based on the degree of genetic exchange between their gene pools
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!