1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kotykmax [81]
3 years ago
15

Which of the following explains why nonrenewable energy resources are still so widely used. Select multiple

Biology
1 answer:
egoroff_w [7]3 years ago
6 0
Non renewable resources can be very expensive, especially in capital outlay. For example, wind energy is very expensive to get started. The batteries alone are a headache. What do you do with those batteries whose life is over? How do you dispose of them? It isn't an easy problem to solve.

Then there's the labor part of wind energy. If they are manufactured in Denver Co and they receive an order from Maine, the blades require a wooden plywood box to be made. Plywood is roughly 20$ a 1/2 sheet (in Canada) to say nothing of the carpenter needed to make the box. I'm told that it takes a good day and one half just to make that box alone. That's for 1 blade. Then there's the shipping cost for 3 blades. Then there's the cost of making the blades which require highly skilled workers. 

Then there's the problem of wind, (or lack thereof). the problems just keep on going up and the expenses with them. 
You might be interested in
How do observations relate to hypothesis
Umnica [9.8K]
The hypothesis is what you think before you get your result so observations can  influence your hypothesis
8 0
3 years ago
In part of the model, materials move out of the bag and into the water. which
stepan [7]

Answer:

small molecules easily pass through the phospholipids in the cell membrane

4 0
1 year ago
What is the term for a group of interbreeding organisms that are able to produce fertile young?
timurjin [86]
Biological species is the term for a group of interbreeding organisms that are able to produce fertile young. 
5 0
3 years ago
Blood moves from the heart to the body in which of the following?
pshichka [43]
Arteries always flow away from the heart versus veins which carry blood to the heart. Bronchi are part of the lungs and move air. Platelets are components of blood that are responsible for clotting the blood.
7 0
3 years ago
Suppose that part of an amino acid sequence of a protein changed from tyrosine-proline-glycine-alanine to tyrosine-histidine-gly
stira [4]

Suppose that part of an amino acid sequence of a protein changed from tyrosine-proline-glycine-alanine to tyrosine-histidine-glycine-alanine. This change was most likely caused by a point mutation called a <u>substitution</u>.

<u>Explanation:</u>

Any protein is synthesized by joining a number of amino acids together. This amino acid is placed based on the sequences of the DNA , for every 3 sequence there is an amino acid that is synthesized and therefore it is called as a triplet codon, since there may be many sequence for a single amino acid we call it as degenerate codon.

7 0
3 years ago
Other questions:
  • Describe the word homeostasis, and why would homeostasis not be maintained if the cell membrane was damaged?
    11·1 answer
  • Which action might lead scientists to develop new explanations about the
    9·1 answer
  • How does the body react when the outside temperature gets too hot?
    6·1 answer
  • True or false does Pressure increases from Earth's surface toward the center of Earth.
    10·1 answer
  • Viruses are different from bacteria in that
    7·2 answers
  • A rabbit is a because it gets its energy from eating other living organisms. A fungus is a because it gets its energy from break
    7·1 answer
  • During anatomy class, the students learn that what structure in the body is a muscular tube with a ciliated lining that is const
    14·1 answer
  • The diameter of the........... is so thin that only one red blood cell can get through at a time.
    8·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which organelle is responsible for making lipid molecules that will be used by the cell?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!