1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sineoko [7]
3 years ago
10

Which of the following is true with respect to the relationship between the greenhouse effect and global warming? The greenhouse

effect
A) is not related to the global warming process
B) contributes to the overall global warming process
C) causes an increase in greenhouse gases
D) does not impact contributes the amount of ozone
Biology
1 answer:
Hatshy [7]3 years ago
4 0

i think B is the answer

You might be interested in
Which commercial technology commonly uses plasmas?.
vladimir2022 [97]

Answer:

A television set

Explanation:

A television shows visuals and this uses the plasma technology

7 0
2 years ago
The lens within an eye focuses light onto the
zubka84 [21]
<span>Eyes are sensitive to light and when light falls on them, they transmit electrical signals to the brain. The lens in the eye focuses light falling on it, on to the retina. Depeding on the amount of light and distance of objects from the eyes, the lens changes shape to allow focus on objects at varying distances and this is called accommodation.</span>
5 0
3 years ago
Select all the answers that apply.
lilavasa [31]

Answer;

  • radiometric dating of rocks
  • fossil evidence
  • gradual processes of rock

Explanation;

Radiometric dating confirms that Earth is ancient and explains how extremely slow processes can result in major changes to Earth’s surface. Evidence from radiometric dating indicates that Earth is about 4.54 billion years old. The geology or deep time of Earth's past has been organized into various units according to events which took place.

-The ages of Earth, Moon, and meteorites, radiometric dating has been used to determine ages of fossils, including early man, timing of glaciations, ages of mineral deposits, recurrence rates of earthquakes and volcanic eruptions, the history of reversals of Earth's magnetic field, and the age and duration of a wide variety of other geological events and processes.

7 0
3 years ago
Read 2 more answers
What are unicellular organisms<br>with<br>examples<br>what is the function of plasma membrane​
Jet001 [13]
The plasma membrane, or the cell membrane, provides protection for a cell. It also provides a fixed environment inside the cell. And that membrane has several different functions. One is to transport nutrients into the cell and also to transport toxic substances out of the cell.
7 0
3 years ago
What is condensation
RUDIKE [14]

Condensation is the phase change from gas to liquid.  You can see condensation in the real world if you have a very cold drink.  A bottle of water filled with ice will attract water vapor from the air, and it will condensate around the bottle because the temperature is lower, which facilitates the phase change.  The outside of the bottle will contain a bunch of water droplets.

Hope this helps!!

3 0
4 years ago
Read 2 more answers
Other questions:
  • ___ are devices that control fluid power within transmission lines
    14·1 answer
  • Which of the following apply to food webs? Select all that apply
    6·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which is a point mutation?
    11·1 answer
  • What are the four major components of the earth's crust?
    7·2 answers
  • 3. In what three ways does a stream transport its load?
    9·1 answer
  • PLZ HELP I'M NOT TRYING TO GO TO SUMMER SCHOOL I WILL BRAINLIST YOU
    7·1 answer
  • Transport proteins allow ___ type of substance to move across the membrane
    10·1 answer
  • WILL GIVE BRAINLIEST IF RIGHT
    12·2 answers
  • The tRNA with the anticodon CGC should have linked at its 3 'terminal to the amino acid:
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!