The correct answer to this question is letter A. Speciation. <span>The Galapagos finch species are an excellent example of speciation. It was Charles Darwin himself who is responsible and made the start of the study in Genetics through his natural selection and survival of the fittest. Hope this helps answer your question.</span>
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
What makes studying people difficult is that you are yourself. You will always be different from other humans, so studying them naturally takes you out of your comfort zone
2. Removing a phosphate group from an ATP molecule, the other processors will need energy
