1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sladkaya [172]
3 years ago
14

What is climate change​

Biology
2 answers:
klemol [59]3 years ago
8 0

Answer:

Climate change is a change in the usual weather found in a place.

Extra:

a change in regional climate patterns, attributed largely to the increased levels of atmospheric carbon dioxide produced by the use of fossil fuels.

Elza [17]3 years ago
3 0

Answer:

Climate change includes both global warming driven by human-induced emissions of greenhouse gases and the resulting large-scale shifts in weather patterns

hope this helps

have  a good day :)

Explanation:

You might be interested in
Please help me out with this. It’s very important
prisoha [69]

Answer:

Hey there

1 It will make it loud for them; negitive

2 It will disturb the wildlife and natural processes; negitive

3 It will remove plants in order to insert the road and animals will get hit by cars going on the road; negitive

4 More roads more cars more driving more pollution; negitive

5 It will make it easier for logging companies because they can hall more wood; negitive

6 Sense there is a new road it will be easier for tourist to come; negitive

8 0
3 years ago
This is showing possible outcomes, genotypes and phenotypes, of offspring from two parents. This is usually shown using a Punnet
damaskus [11]

Answer:

The answer will be Genetic Cross

Explanation:

3 0
3 years ago
Read 2 more answers
Both MDMA ( or Ectasy) and PCP have recently been reclassified as___ hallucinogenic drugs.
Rom4ik [11]
Both MDMA ( or Ecstasy) and PCP have recently been reclassified as recreational hallucinogenic drugs. <span>The recreational drug is a psychoactive drug that induces an altered state of consciousness. It is used for pleasure because it modifies the perceptions and feelings of the one who uses it.</span>
6 0
3 years ago
Read 2 more answers
1. Analyze Less than 20% of the Nahmint and Nanaimo Rivers were stocked with
BartSMP [9]

Answer:

Captive breeding and release programs, widely used to supplement populations of declining species, minimize juvenile mortality to achieve rapid population growth. However, raising animals in benign environments may promote traits that are adaptive in captivity but maladaptive in nature. In chinook salmon, hatchery rearing relaxes natural selection favoring large eggs, allowing fecundity selection to drive exceptionally rapid evolution of small eggs. Trends toward small eggs are also evident in natural populations heavily supplemented by hatcheries, but not in minimally supplemented populations. Unintentional selection in captivity can lead to rapid changes in critical life-history traits that may reduce the success of supplementation or reintroduction programs.

Explanation:

5 0
3 years ago
PLEASE help with these! I still have a lot more questions I need help with too, if nyone can help please do, thank you!!
olga2289 [7]
8)the answer is c
9)the answer is d
5 0
3 years ago
Read 2 more answers
Other questions:
  • The peripheral nervous system consists of all the nervous tissue external to the cns true or false
    6·2 answers
  • In regards to the procedures when giving a diagnosis, a ________.
    14·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • ___________ of glucose produces glycogen, the storage form of sugar, found in the liver and muscles.
    9·1 answer
  • Essay about how coronavirus has affected the small business ​
    12·1 answer
  • How is the total magnification of a cell calculated
    7·2 answers
  • PLEASE HELP!
    13·1 answer
  • What are the advantages and disadvantages of robots?
    7·2 answers
  • Which type of mining is likely the least harmful to the environment?
    9·1 answer
  • Whats the correct answer answer asap for brainlist
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!