1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iris [78.8K]
2 years ago
7

What are the three main factors of the cell theory, and which parts of the previous cell theory can be disproven?

Biology
1 answer:
Hoochie [10]2 years ago
4 0

structure, function and organism should be it sorry if i am wrong

You might be interested in
A goal of using animal models is to explain the molecular detail of specific behaviors encoded in the human brain. How would you
oksian1 [2.3K]

Answer:

It is possible to compare the expression of homologous genes in the brain of <em>D. melanoganster</em> and humans, because the expression levels of conserved genes may be associated with the evolution of cognitive features such as complex learning and memory.  

Explanation:

Model organisms can be used to understand the patterns and processes that affect human evolution. <em>Drosophila melanogaster </em>is a model organism that has been used to study expression patterns of conserved genes in the course of evolution. This model organism has also been used to develop genetic mutant lines in order to examine the role of genes evolutionarily conserved in animals, including those involved in neurocognitive development.

In genetic research, an experiment as the above described is framed in a research field named 'Behavioral Genetics', which is a discipline that studies how evolutionarily conserved gene networks may be associated with neurocognitive tasks during brain evolution.

7 0
3 years ago
WILL MARK BRAINLEIST IF RIGHT
DochEvi [55]

Answer:

c

Explanation:

6 0
3 years ago
Read 2 more answers
A population of tree-climbing lizard live on one bank of a large river. The other bank of the river is a treeless prairie. Durin
algol13

It would be mutation cause

3 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Leigh's disease is a mitochondrially inherited disease with symptoms that include seizures, fatigue, impaired reflexes, breathin
Ahat [919]

About the question:

You will find the pedigree in the attached files

Answer:

  • individual 4 → Affected woman → Black circle
  • individual 5 → Affected woman or man → Black circle or square
  • individual 7 → Healthy woman → Empty circle
  • individual 10 → Affected boy → Black Square

Explanation:      

Mitochondrial inheritance is the transmission of a disease or a trait from the maternal line.

<em>Most of the DNI is in the nucleus, but there is also DNI in mitochondria. Sperm cells hardly transfer mitochondrial genes to the progeny</em>, so mitochondrial DNI is mostly inherited from the maternal side. If there exists any mutation in this mitochondrial DNI, the whole progeny of the mutated woman will be affected, as they will get the mother genotype carrying the mutation. On the contrary, if an affected man is carrying a mutation in mitochondrial DNI, non of their descendants will get the disease.

Before answering the question, let us remember the pedigree symbols.

  • Squares represent Males/Men
  • Circles represent Females/Women
  • Empty symbols represent healthy/non-affected individuals
  • Solid black symbols represent sick/affected individuals

In the exposed pedigree, we can see that the mother is affected by the disease (individual number 2), so all her children are also affected (individuals 4, 5, and 6) because the <em>disease is mitochondrially inherited</em>.

Individual 3 is a healthy man, so individual 4 must be an affected woman (Black circle). As she is the one affected, then all her children will also be affected. This couple <em>had one boy and two girls</em>. Individuals 8 and 9 are girls (circle), so individual 10 must be the affected boy (black square).  

On the other hand, individual 6 is an affected man (black square), son of individuals 1 and 2. This man couples with a woman, and they have all healthy children. So this woman (individual 7) must be healthy. Even though the man is affected, all their children are not because their mother (7) is not. Remember that sperm cells do not transmit the mitochondrial genes to the progeny.      

And finally, individual number 5 might be either a man or a woman. In any case, this person is also affected by Leigh's disease.  

5 0
3 years ago
Other questions:
  • This illustration shows the process of making a protein molecule. The site of protein synthesis in a cell is the ____
    6·2 answers
  • If planets do not produce their own light, how are we able to see mars and Venus in the night sky
    10·2 answers
  • What is the function of these hormones:<br> Renin<br> Anti-diuretin<br> Calcitonin <br> Thyroxine
    6·1 answer
  • two martians, betty and ben want to have a child. they both have one eye but are hoping to have a three eyed baby. is this possi
    15·1 answer
  • Which of the following factors would affect population distribution but not size in a given country
    6·1 answer
  • understanding density can help you predict if a. an object will roll. b. an object will deflate. c. an object will sink or float
    5·1 answer
  • in order to draw the food web correctly, which organisms should have two arrows pointing toward them?​
    9·1 answer
  • The four groups of organic compounds found living things are carbohydrates , lipids , nucleic acids
    9·1 answer
  • Bacteria make up 90 percent of the microorganisms found in most types of soil. Many types of
    13·1 answer
  • How have microscopes helped people learn about living things on a different scale?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!