1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nekit [7.7K]
3 years ago
5

N pea plants, yellow (Y) seed color is a dominant trait, and green seed color (y) is a recessive trait. Which resulting plant wi

th yellow seeds could produce a plant with green seeds in the next generation?
YY

Yy

yy

Yg

Biology
2 answers:
GarryVolchara [31]3 years ago
6 0
I believe the answer is Yy. Although Y represents the dominant trait for yellow, it being paired with the recessive trait, y, has the chance of a plant with green seeds to be produced in the next generation.
olga55 [171]3 years ago
4 0

Answer:

Yy

Explanation:

We are given that n pea plants,

Yellow (Y) seed color is  dominant color and green seed color (y) is a recessive trait.

Dominant trait:The allele  which shows their effect  in a pair of allele .The trait shown by allele is called dominant allele.

Recessive trait.The allele which does not show their effect in a pair of allele.Then,the trait not shown by allele in a pair of allele is called recessive trait.

When a plant with yellow seed(Yy) it mean yellow color is  dominant color and green is recessive in plant cross with self then the plant can produce yellow seed and green seed plants in next generation.

It we take YY then there is no allele for green color so the plant can not produce green seed plant in next generation.

yy can not take because we are given that we have taken yellow seed plant but yy is green seed plant.

Yg can not take because we are given allele  y  for green color not g.

You might be interested in
Use the data to calculate the percentage remaining for samples Y and Z to the nearest tenth of a percent.
marusya05 [52]

Answer:

Y= 98, 0% , Z = 94,7 %

Explanation:

We use simple 3 rules to find the percentage of purity, using mass data:

Sample Y =

85g----100%

83,30g----X = (83,30gx 100%)/ 85g= 98, 0%

Sample Z =

95g----100%

90g----X = (90gx 100%)/ 95g= 94, 7%

5 0
3 years ago
Read 2 more answers
Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque
Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0
3 years ago
Students who study perform better in school. What is the hypothesis
liraira [26]
That students who study make better grades than those who do not.
4 0
3 years ago
What is most likely a source of air pollution
slamgirl [31]

Answer:

This is easy, CO2 is (Carbon Dioxide) a main cause of air pollution. We put it in the air every day when we drive cars or vehicles. And from wildfires and volcanoes, but they rarely erupt now.

Explanation:

4 0
2 years ago
Read 2 more answers
“The rest is lost largely through metabolic processes as heat.”
stepladder [879]

Answer:

The rest is lost generally through metabolic cycles as warmth.

Hope this helps you. Do mark me as brainliest.

3 0
3 years ago
Other questions:
  • What is the correct order for the layers of the gi tract wall, from innermost (next to lumen) to outermost?
    7·1 answer
  • One school of yoga recommends first inhaling normally and exhaling deeply, and then inhaling deeply and exhaling normally. Infer
    14·2 answers
  • Compare and contrast the two prokaryotic kingdoms. What is one major difference that is apparent?
    5·2 answers
  • Why do scientists think that whales evolved from ancient mammals and not ancient fish
    6·1 answer
  • Which factor should be the same in all three groups?
    15·1 answer
  • Carnivorous plants example .pls I need it now . I will mark brainlest.​
    10·1 answer
  • If you place yeast, sugar and water in a sealed bag and in the sun , what two things will be produced
    14·1 answer
  • Is xylem or schlencyma the tissue that forms annual rings during secondary thickening growth in dicot plant
    12·1 answer
  • Which of the following is an input to the light dependent reaction?
    7·1 answer
  • What causes the overgrowth of algae and Cyanobacteria in an aquatic environment?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!