C.) Scanning electron microscope. You would not be able to see a whole insect with one of these.
Hope this helped :)
The nervous system and the integumentary system<span />
True. <span> Low-intensity stimulation makes the neuron intensify.</span>
Answer:
Explanation:
Oxygen is needed to support life and some metabolic processes in microorganisms especially aerobic organism.
The presence of oxygen in the container gives them the opportunity to carry out there metabolic activities thereby enhancing there growth and multiplication.
Hence, to limit the growth of aerobic bacteria or fungi, and also to prevent the evaporation of volatile components that is available in the content oxygen is withdrawn this help extend the shelf life of the produce to be stored.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
