Epirical formula of P4O10

Deforestation typically

harkovskaia [24]

B. increases erosion in an area

8 0

3 years ago

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

valentina_108 [34]

TACCGAACGGTTCCAGGCCTTTCAAAG

3 0

3 years ago

Which factors must be equal when a reversible chemical process reaches equilibrium?

Anon25 [30]

The concentration of the reactants and products remain constant. Because the rates of the forward and reverse reaction are equal there is no net change to the amount of reactants or products produced.May 19, 2011

3 0

3 years ago

Identify the hybridization of each carbon atom for the molecule above

ipn [44]

Carbons starting from the left end:

sp²
sp²
sp²
sp
sp

Refer to the sketch attached.

<h3>Explanation</h3>

The hybridization of a carbon atom depends on the number of electron domains that it has.

Each chemical bond counts as one single electron domain. This is the case for all chemical bonds: single, double, or triple. Each lone pair also counts as one electron domain. However, lone pairs are seldom seen on carbon atoms.

Each carbon atom has four valence electrons. It can form up to four chemical bonds. As a result, a carbon atom can have up to four electron domains. It has a minimum of two electron domains, with either two double bonds or one single bond and one triple bond.

A carbon atom with four electron domains is sp³ hybridized;
A carbon atom with three electron domains is sp² hybridized;
A carbon atom with two electron domains is sp hybridized.

Starting from the left end (H₂C=CH-) of the molecule:

The first carbon has three electron domains: two C-H single bonds and one C=C double bond; It is sp² hybridized.
The second carbon has three electron domains: one C-H single bond, one C-C single bond, and one C=C double bond; it is sp² hybridized.

The third carbon has three electron domains: two C-C single bonds and one C=O double bond; it is sp² hybridized.
The fourth carbon has two electron domains: one C-C single bond and one C≡C triple bond; it is sp hybridized.
The fifth carbon has two electron domains: one C-H single bond and one C≡C triple bond; it is sp hybridized.

8 0

3 years ago

What is the mass of 8.23 x 10^23 atoms of Ag

Gnom [1K]

Answer:

$\boxed {\boxed {\sf Approximately \ 147 \ g\ Ag}}$

Explanation:

Convert Atoms to Moles

The first step is to convert atoms to moles. 1 mole of every substance has the same number of particles: 6.022 ×10²³ or Avogadro's Number. The type of particle can be different, in this case it is atoms of silver. Let's create a ratio using this information.

$\frac{6.022*10^{23} \ atoms \ Ag}{1 \ mol \ Ag}$

We are trying to find the mass of 8.23 ×10²³ silver atoms, so we multiply by that number.

$8.23 *10^{23} \ atoms \ Ag *\frac{6.022*10^{23} \ atoms \ Ag}{1 \ mol \ Ag}$

Flip the ratio so the atoms of silver cancel. The ratio is equivalent, but places the other value with units "atoms Ag" in the denominator.

$8.23 *10^{23} \ atoms \ Ag *\frac{1 \ mol \ Ag}{6.022*10^{23} \ atoms \ Ag}$

$8.23 *10^{23} *\frac{1 \ mol \ Ag}{6.022*10^{23} }$

Condense into one fraction.

$\frac{8.23 *10^{23} }{6.022*10^{23} } \ mol \ Ag$

$1.366655596 \ mol \ Ag$

Convert Moles to Grams

The next step is to convert the moles to grams. This uses the molar mass, which is equivalent to the atomic mass on the Periodic Table, but the units are grams per mole.