1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zvonat [6]
3 years ago
6

Which of these chemicals is needed in order for the metabolic reactions of photosynthesis to occur?

Biology
2 answers:
vredina [299]3 years ago
7 0

the correct answer is water.

adell [148]3 years ago
3 0
Photosynthesis is 
6 CO2 + 6H2O---> C6H12O6 + 6 O2. So unless I understand the question wrong, none is needed to do, but glucose and oxygen are products after the photosynthesis
You might be interested in
What is the force of resistance acting between objects in contact and tending to dampen their motion?
Zanzabum

Answer: 3.friction

Explanation: friction is a force of resistance acting between objects in contact and tending to dampen their motion

8 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Can someone plz help me? :(
Brums [2.3K]

I suggest that you should try C......

7 0
3 years ago
What is the responsibility of DNA in the cell
Schach [20]

Answer:

It helps make protiens and is like a blueprint for your body.

Explanation:

5 0
3 years ago
Read 2 more answers
Why are alpha rays much more dangerous when the source of radiation is located inside the body?
Afina-wow [57]
Because alpha ray can penatrate the body deeper than other x rays and do more damage

4 0
3 years ago
Other questions:
  • An atom consist of an atomic nucleus composed of positvely charged
    14·1 answer
  • BRAINLIESTTT ASAP!!!!<br><br> How is volume measured for liquids and solids?
    5·2 answers
  • A pond is located beside an open mine. Mercury from the mine contaminates the river water. This is an example of
    15·1 answer
  • Protein supplies approximately __________ percent of a human's typical energy needs.
    15·1 answer
  • Typical fatty acids cannot be converted to glucose because ______________.
    12·1 answer
  • Where is the hair pigment<br> located?
    10·1 answer
  • It is impossible for sperm to be functional (able to fertilize the egg) until after ________. Group of answer choices
    5·1 answer
  • 1Which of the following animals is a primary consumer?
    7·1 answer
  • 1. Which items best describe a desert?
    12·1 answer
  • Which organelles appear ONLY in plant cells? Explain. (Question 2)​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!