1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kow [346]
3 years ago
11

Net Force: N Direction: Balanced or Unbalanced:

Biology
1 answer:
Vitek1552 [10]3 years ago
6 0

Answer:

balanced

Explanation:

Equal forces are being applied from opposite sides, so they cancel out. Think about pushing on both sides with the same amount of pressure on both sides. Its not gonna move. Hope I could help!

You might be interested in
Janet installed a dimmer on the lights in her bedroom. She slid the dimmer switch, causing the resistance in the circuit to
Anton [14]

Answer: The correct answers are option(b) and(d).

Explanation:

When the lamp was dimmer  the resistance offered by the lamp was more which just resist the flow current from the circuit.

V=RI (Ohm's Law)

When the Janet decrease the resistance to (R') by sliding the dimmer switch (voltage remained constant). On decreasing the resistance the flow of current in circuit will increase by which light of the lamp will become brighter.

Hence, from the enlisted options the correct options option(b) and(d).

4 0
3 years ago
Read 2 more answers
In human, there are 22 pairs of chromosomes called
lara [203]

Females have two copies of the X chromosome, while males have one X and one Y chromosome. The 22 autosomes are numbered by size. The other two chromosomes, X and Y, are the sex chromosomes. This picture of the human chromosomes lined up in pairs is called a karyotype.

Of the 23 pairs of chromosomes, the first 22 pairs are called "autosomes." The final pair is called the "sex chromosomes." Sex chromosomes determine an individual's sex: females have two X chromosomes (XX), and males have an X and a Y chromosome (XY).

4 0
3 years ago
Why is virus considered as connecting link between living and non living?
Anastaziya [24]

Virus is non living, but once it gets a host (something to live on), it is a living being.

5 0
2 years ago
Description of Building the Tree of Life
Leya [2.2K]

Answer:

In this way, the tree of life is a symbol of a fresh start on life, positive energy, good health and a bright future. As a symbol of immortality. A tree grows old, yet it bears seeds that contain its very essence and in this way, the tree becomes immortal. As a symbol of growth and strength.

Explanation:

The Tree of Life symbol represents our personal development, uniqueness and individual beauty. Just as the branches of a tree strengthen and grow upwards to the sky, we too grow stronger, striving for greater knowledge, wisdom and new experiences as we move through life.

7 0
3 years ago
Which of these activities helps to identify keywords related to a specific author?
Kay [80]
Reading background information because it gives ideas from the author himself.
7 0
3 years ago
Read 2 more answers
Other questions:
  • PLEASE ANSWER THESE QUESTIONS COMPLETELY!!! WILL MARK BRAINLIEST!!!
    12·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What controls traits and inheritance
    14·2 answers
  • Why is the flow of energy important
    13·1 answer
  • Which type of chemical bond is an attraction between existing compounds
    9·1 answer
  • Census data show that the human population doubled from 2.65 billion in 1953 to 5.3 billion in 1990. If it continues to double a
    14·2 answers
  • Which of the following is a likely result of deforestation?
    12·1 answer
  • A phagocytic cell has a mutation in a gene for a hydrolytic enzyme that renders the enzyme nonfunctional. What is the most likel
    8·1 answer
  • Explain the WHO, WHAT, WHERE, WHEN, and WHY of how Illinois water towers came to be. Tell the history of Illinois towers, why th
    11·1 answer
  • Select ALL the functions of the digestive system
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!