1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sophie [7]
3 years ago
7

Plz help me!

Biology
2 answers:
MrRa [10]3 years ago
5 0

The right answer is A.

We have found more than 200 important mutations of the GAA gene, which alter the proper functioning of acid alpha glucosidase, reducing its activity and generating an excess accumulation of glycogen in lysosomes. This accumulation leads to Pompe disease, or glycogen storage disease II.

Rama09 [41]3 years ago
3 0

Its A enzymes are like a lock and key, if it is changed it wont fit, and they enzyme cant break down the glucose.

You might be interested in
Describe why this is a controlled experiment.
denis23 [38]
A Only one variable changed
3 0
2 years ago
What does the lack of nourishment for the surviving plant in a raisin in the sun most likely reflect?
kenny6666 [7]
The options to this question are:

A. The strength of Mama's children
B. The hope in Walter's dream
C. The sour feelings among the characters
D. The need to embrace

The best answer is: 
the lack of nourishment for the surviving plant in a raisin in the sun most likely reflects  "The strength of Mama's children".

<span>A plant in a raisin basically represents a mama's dream that there will a day when she will have her own house with a small garden in the backyard.</span>

5 0
3 years ago
What organelle assist trna in translating the mrna in the cyto plasm?
Ahat [919]
It is the ribosomes that assist tRNA
8 0
3 years ago
Which of the following is Not true about genome?
Nady [450]

Answer:

B-The human genome and a chimpanzee genome would be exactly the same.

4 0
3 years ago
when metals, nonmetals, and metalloids are compared according to luster, which is the best description of the appearance of meta
Harlamova29_29 [7]

Answer:

D they are both because they can be both metals and no metals

Explanation:

6 0
2 years ago
Other questions:
  • Brenda and her friend are relaxing in a paddleboat, slowly working the paddles with their legs to move the boat. Which organelle
    10·2 answers
  • Plasma is mostly made of _____.<br><br> water<br> waste<br> salt<br> nutrients
    5·2 answers
  • The major body system that coordinates the reception of stimuli and transmits messages throughout the body is known as __. The L
    7·1 answer
  • During aerobic cellular respiration, ___________ combines with hydrogen ions and the product is released as a by-product of resp
    12·1 answer
  • Phospholipids make up most of the lipid part of the cell membrane. Since water exists on both the outside and inside of a cell,
    9·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • 1- ¿Por qué son importantes las semillas nativas?
    5·1 answer
  • The retreat of the shallow seas of the Paleozoic left much of Virginia exposed during the Permian and Mesozoic. In central Virgi
    11·2 answers
  • Place the steps tor the formation of the enzyme pepsinogen in correct order
    10·2 answers
  • Al cruzar una ´planta de arveja de flores purpura con otra de flores blancas mendel obtuvo una f1 formada por las plantas de flo
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!