1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Whitepunk [10]
3 years ago
6

What makes a resource renewable?

Biology
1 answer:
MrMuchimi3 years ago
8 0
Renewable energy refers to the provision of energy via renewable resources which are naturally replenished fast enough as being used. it includes e.g. sunlight, wind, biomass, rain, tides, waves and geothermal heat.
You might be interested in
How do you know that matter is conserved during the process of cellular respiration?
kow [346]
C hope that helps have a great day :))))
8 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
What is lunar dust made of??? please help me out here!!
rewona [7]

Answer: Lunar dust is made up of silicates

Explanation: 42% oxygen

21% silicon

13% iron

8% calcium

7% aluminium

6% magnesium

6 0
3 years ago
Why do you think UV intensity changes with latitude?
Furkat [3]

Answer:

Because of the angle of the Earth relative to the sun. The higher the sun is in the sky, the higher the UV radiation level.

Explanation:

So, the lattitudes toward the poles that receive sunlight are at an oblique angle, with that being said, the amount of radiation is spread to a larger area than the equator.

6 0
3 years ago
What two types of amino acid sequences are needed in a protein to mediate post-translational farnesylation?
Hitman42 [59]

Answer:

Post translation farnesylation may be defined as a type of prenylation in which the isoprenyl group is added to the cysteine residues of the protein. This modification is important for protein and membrane interaction.

Basically two types of amino acid are required for the farsenylation modification. The signal peptide sequence is the short amino acid sequence that targets the ribosome in the endoplasmic reticulum. The sequence is generally lysine, aspartic acid, glutamic acid and leucine. The second sequence must be Caax (C is cysteine, a is aliphatic amino acid and X consists of C terminal amino acid.

8 0
3 years ago
Other questions:
  • Carla wants to become a florist. Studying which of the following branches of science would be most helpful for Carla's future ca
    10·2 answers
  • Which of the following is a benefit of dams?
    5·2 answers
  • Okay I need help on this question
    11·2 answers
  • Which of these is true for a daughter cell produced by mitosis?
    8·2 answers
  • What is the term for a special layer that acts as a color filter for a single layer or for all the layers beneath it?
    15·1 answer
  • Where is transcription located? (assuming eukaryote cell)
    14·1 answer
  • Select all that apply.
    8·1 answer
  • Identify the category each organism belongs to, based on the food it consumes.
    5·2 answers
  • The higher
    10·2 answers
  • A carrier (heterozygous) marries a pure normal skinned person, what is the probability they will have a child that is albino?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!