1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Jobisdone [24]
3 years ago
14

Which two of these characteristics does an organism with bilateral symmetry possess?

Biology
2 answers:
Oksanka [162]3 years ago
6 0
<span>Choices (b) and (c) are the most correct. Bilateral symmetry requires a central axis for there to be two halves. In addition, this type of symmetry requires a head, which will encounter the environment before any other part of the body and move in the direction of travel. Most animals exhibit this characteristic.</span>
sukhopar [10]3 years ago
3 0

Answer:

The correct answers are options B. "symmetrical in many ways across a central axis" and C. "presence of a head".

Explanation:

Bilateral symmetry is a characteristic that many organisms has at which if we divide the body using an imaginary line, we will see two mirror images. Two characteristics that an organism with bilateral symmetry possess are symmetrical in many ways across a central axis (known as well as the sagittal plane), and presence of a head that is at the middle of the central axis. The great majority of organisms posses bilateral symmetry, including the humans.

You might be interested in
Which processes of the water cycle retum water vapor<br> directly to the atmosphere?
bekas [8.4K]

Answer:  the answer is evaperation :)

8 0
3 years ago
Which of the following is a disadvantage of wind as an energy source?
lesya692 [45]

Explanation:

Wind energy is one of the sources of renewable sources of energy that is environmentally friendly.

It uses wind power to generate other forms of energy mostly electricity.

Some of the drawbacks are:

  • Wind turbines pose serious threat to wildlife. It is common place to see dead birds in areas where wind power is being harnessed.
  • The quantity fluctuates from time to time. Since wind is an element of weather, it is not always in regular supply as desired.
  • The cost of constructing wind turbines can be very high a times.

Learn more:

Non-renewable sources of energy brainly.com/question/3386515

#learnwithBrainly

4 0
3 years ago
While water vapor is a necessary gas phase in the atmosphere for the hydrologic cycle, it is a natural greenhouse gas. Water vap
alisha [4.7K]

Answer:

Water vapor is a greenhouse gas, which absorbs the heat radiated from the earth's surface. It allows less heat to escape back to space by trapping the heat energy in the lower atmosphere and keeps the atmosphere warm.

Explanation:

Water vapor is formed through a process called evaporation. In this process, water from the ocean, rivers, and lakes evaporates to become water vapor using the energy from the sun. Water vapor also moves into the atmosphere by transpiration (plants) and sublimation (snow and ice).

The water vapor cools down and transforms into water droplets by a process called condensation, as it rises high in the atmosphere where the air is cooler. This water droplets that formed by condensation make up clouds.

When the earth’s surface get heated by the sunlight, some of the heat radiates back into the atmosphere and most of this heat is absorbed by gases in the atmosphere called green house gases. This process is called greenhouse effect, which keeps the earth warm. The green house gases mainly consists of carbon dioxide and water vapor. Water vapor absorbs the heat radiated from the earth's surface. It allows less heat to escape back to space by trapping the heat energy in the lower atmosphere and keeps the atmosphere warm.

The amount of water vapor in the atmosphere is directly proportional to the temperature. When addition of the other greenhouse gases causes a temperature increase (such as extra CO2 from fossil fuels), more water evaporates and this leads to an increase in water vapor which further increases the atmospheric temperature since water vapor is a greenhouse gas. So, water vapor is part of a positive feedback system.

8 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
Which of the following is not one of the nitrogen bases that form the rungs of the ladder in DNA? a. adenine 2. cytosine 3. fran
Amiraneli [1.4K]

Answer:

3 francine

Explanation:

The four nitrogenous bases that compose DNA nucleotides are shown in bright colors: adenine (A, green), thymine (T, red), cytosine (C, orange), and guanine (G, blue). francine is not one of them

6 0
3 years ago
Read 2 more answers
Other questions:
  • An unknown black mineral must be identified as one of the minerals on this data table
    14·2 answers
  • All BUT one of these occur during metaphase I of meiosis. Which of these would NOT occur during the metaphase I phase of meiosis
    6·1 answer
  • Match the terms with the correct definitions. 1. a nonprotein molecule or ion that is needed for an enzyme to carry out catalysi
    12·1 answer
  • Which is an advantage of eukaryotic cell structure over prokaryotic cell structure?
    7·1 answer
  • What is a carbohydrate? List three facts about glucose. Assume that you are trying to identify an unknown organic molecule. It c
    14·2 answers
  • What kind of flower was Timon wearing on his head in the hula scene of the lion king 1994?
    15·1 answer
  • What is the relationship between a stimulus and a response?
    14·1 answer
  • 2. How do cells transform energy from food in the absence of oxygen?
    12·1 answer
  • Please answer this:)) :((​
    12·1 answer
  • ACTIVITY 2: BIKINI BOTTOM GENETICS INSTRUCTIONS: PART A: Smiley Face Traits (1) Get two coins and mark one coin with a "F" and t
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!