Answer: the answer is evaperation :)
Explanation:
Wind energy is one of the sources of renewable sources of energy that is environmentally friendly.
It uses wind power to generate other forms of energy mostly electricity.
Some of the drawbacks are:
- Wind turbines pose serious threat to wildlife. It is common place to see dead birds in areas where wind power is being harnessed.
- The quantity fluctuates from time to time. Since wind is an element of weather, it is not always in regular supply as desired.
- The cost of constructing wind turbines can be very high a times.
Learn more:
Non-renewable sources of energy brainly.com/question/3386515
#learnwithBrainly
Answer:
Water vapor is a greenhouse gas, which absorbs the heat radiated from the earth's surface. It allows less heat to escape back to space by trapping the heat energy in the lower atmosphere and keeps the atmosphere warm.
Explanation:
Water vapor is formed through a process called evaporation. In this process, water from the ocean, rivers, and lakes evaporates to become water vapor using the energy from the sun. Water vapor also moves into the atmosphere by transpiration (plants) and sublimation (snow and ice).
The water vapor cools down and transforms into water droplets by a process called condensation, as it rises high in the atmosphere where the air is cooler. This water droplets that formed by condensation make up clouds.
When the earth’s surface get heated by the sunlight, some of the heat radiates back into the atmosphere and most of this heat is absorbed by gases in the atmosphere called green house gases. This process is called greenhouse effect, which keeps the earth warm. The green house gases mainly consists of carbon dioxide and water vapor. Water vapor absorbs the heat radiated from the earth's surface. It allows less heat to escape back to space by trapping the heat energy in the lower atmosphere and keeps the atmosphere warm.
The amount of water vapor in the atmosphere is directly proportional to the temperature. When addition of the other greenhouse gases causes a temperature increase (such as extra CO2 from fossil fuels), more water evaporates and this leads to an increase in water vapor which further increases the atmospheric temperature since water vapor is a greenhouse gas. So, water vapor is part of a positive feedback system.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
Answer:
3 francine
Explanation:
The four nitrogenous bases that compose DNA nucleotides are shown in bright colors: adenine (A, green), thymine (T, red), cytosine (C, orange), and guanine (G, blue). francine is not one of them