The study pushes back the clock on the origin of Earth's water by hundreds of millions of years, to around 4.6 billion years ago, when all the worlds of the inner solar system were still forming. Scientists had suspected that our planet formed dry, with high-energy impacts creating a molten surface on the infant Earth.
Answer: 4.6 billion years.
Because the three-horned alien is heterozygous, we know that three must be dominant to four, because the gene for the three horns is "hiding" the gene for four horns. Therefore, the three-horned alien has the genotype Tt (T for three horns, and t for four horns). The four horned alien must be tt, because that is the only way that a recessive trait may be seen. If you solve the punnet square on a cross between Tt and tt, you end up with half three (heterozygous) and half four (homozygous recessive) it is a bit easier to explain with something a little "closer to home" if you want me to explain it again, just say so, I don't mind!
Answer:
Columnar epithelial tissue.
Explanation:
The above scenario confirms that these are simple columnar epithelial tissue because columnar cells are tall, narrow and nucleus in the tall column like cells located at the basal end of the cells. Columnar epithelial tissue are responsible for absorption and secretion of molecules. These are present at some part of digestive tract, female reproductive tract, and respiratory system.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Glucose is a product of photosynthesis. Glucose is also a type of starch.
