1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dybincka [34]
3 years ago
12

A nurse is interacting with a depressed, suicidal client. what themes in the client's conversation are of most concern to the nu

rse?
Biology
1 answer:
Shalnov [3]3 years ago
4 0
Loneliness and hopelessness
You might be interested in
Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
Tomtit [17]

Answer:

I'll break this into threes so its easier to read;

TTC ATG CTA GCT ACG TGT ACG TAC CGA TGC G

Explanation:

In DNA, the A bases goes with the T bases, and the C bases go with the G bases.

3 0
4 years ago
5. What type of bond can be found between complementary nitrogenous bases?
zzz [600]
They form hydrogen bonds between opposing dna which forms the twister ladder of dna
5 0
3 years ago
Select True or False: Using your knowledge of osmosis or osmotic pressure decide if the following statement is true or false: Wh
Inessa [10]

Answer:

True

Explanation:

Osmosis refers to the movement of water particles from a region of low concentration to a region of high concentration.

When sprinkled with sugar, a dish of sliced fruit will form its own juice. This is because the sprinkled sugar has a higher concentration which explains why water moves out from the fruit with a lower concentration to dilute the sugar which has a higher concentration.

8 0
4 years ago
What effect would hypotension have on the capillary hydrostatic pressure gradient and net filtration pressure?
Alla [95]

Hypotension will  cause the interstitial fluid hydrostatic pressure to increase and capillary hydrostatic pressure to decrease. The net filtration pressure will be reduced favoring the absorption .

Explanation:

Hypotension refers to reduced blood pressure. Decrease in blood pressure results in reduced filtration pressure on capillary walls. This reduces the filtration of water and solutes into the tissue fluid but will favor the movement of water from tissue to blood. So we can say that net filtration pressure will be reduced.

7 0
3 years ago
Which membrane would show a more rapid recovery of fluorescence in a frap study?
ziro4ka [17]

Answer: a membrane containing a larger proportion of unsaturated fatty acids

Explanation:

4 0
3 years ago
Other questions:
  • What are TWO functions of citric acid in the feta cheese? What are the TWO functions of agar in the feta cheese?
    8·1 answer
  • Environmental manipulation can result in unforeseen consequences true or false
    12·2 answers
  • What are traits? A)small hairs that grow on you’re forehead. B)characteristics passed from parents to children. C)people that ar
    9·2 answers
  • Karissa is conducting an experiment on the amount of salt that dissolves in water at different temperatures. She repeats her tes
    15·1 answer
  • List to structures that have similar functions in plants and animals. How are they different?
    6·1 answer
  • Which of the following is part of the peripheral nervous system?
    5·1 answer
  • Why do neurons need a steady supply of atp?
    13·1 answer
  • A group of organisms of the same species that live in an area.
    14·2 answers
  • The availability of glucose energy necessary for memory consolidation is most likely to be enhanced by
    7·1 answer
  • External cell membranes function to
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!