Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
The term biochemical is a contraction that refers to the consideration of biological, geological and chemical apect of each cycle.
A nutrient reservoir is used to hold the water/ nutrient mixture plant need for strong growth and good health
Explanation:
<em>H</em><em>o</em><em>p</em><em>e</em><em> </em><em>T</em><em>h</em><em>i</em><em>s</em><em> </em><em>H</em><em>e</em><em>l</em><em>p</em><em>e</em><em>d</em><em> </em><em>You</em><em>!</em><em>!</em><em>!</em>
The wind speed is C. 105 to 177mph
Fixed action patterns are <span>behaviors that follow a fixed, unvarying pattern and are used in accordance to studying animals and their behaviors to both the environment and each other. </span>
Answer:
I feel happy and sorry.
Explanation:
I have different feelings when I go back and analyze the decisions and actions I have taken in the past few days because some of my decisions are right and some are wrong. I feel happy when I go back and find out my decision and actions were right, while on the other hand, I feel sorry when I find out that some of my decisions and actions were wrong.