1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svetlana [45]
3 years ago
5

Identify where you will find seminiferous tubules in the male reproductive system.

Biology
2 answers:
kherson [118]3 years ago
5 0

Answer:

Within the testes.

Explanation:

The seminiferous tubules are parts of male reproductive system, at where germination and maturation of sperms takes place. The seminiferous tubules are present within the testes and they provide site for meiosis as gametes are produced by meiotic division of germ cells.

Thus, one can find seminiferous tubules within the testes in male reproductive system.

postnew [5]3 years ago
3 0
The testes is where you will find them            
You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
What are:<br> Biochemical cycles and reservoirs for nutrients.<br><br> Thanks!
WINSTONCH [101]

Answer:

The term biochemical is a contraction that refers to the consideration of biological, geological and chemical apect of each cycle.

A nutrient reservoir is used to hold the water/ nutrient mixture plant need for strong growth and good health

Explanation:

<em>H</em><em>o</em><em>p</em><em>e</em><em> </em><em>T</em><em>h</em><em>i</em><em>s</em><em> </em><em>H</em><em>e</em><em>l</em><em>p</em><em>e</em><em>d</em><em> </em><em>You</em><em>!</em><em>!</em><em>!</em>

5 0
2 years ago
Read 2 more answers
Most tornadoes carry wind speeds in the range of _______ km per hour.
Alex73 [517]
The wind speed is C. 105 to 177mph
5 0
4 years ago
Fixed action pattern???<br> Wha????
bija089 [108]
Fixed action patterns are <span>behaviors that follow a fixed, unvarying pattern and are used in accordance to studying animals and their behaviors to both the environment and each other. </span>
7 0
4 years ago
Read 2 more answers
ano ang iyong naramdaman nang balikan at suriin mo ang pagpapasiya at pagkilos na isinagawa mo ng mga nagdaang araw​
lyudmila [28]

Answer:

I feel happy and sorry.

Explanation:

I have different feelings when I go back and analyze the decisions and actions I have taken in the past few days because some of my decisions are right and some are wrong. I feel happy when I go back and find out my decision and actions were right, while on the other hand, I feel sorry when I find out that some of my decisions and actions were wrong.

8 0
3 years ago
Other questions:
  • It is the most common metrical pattern in English poetry.
    14·1 answer
  • The humerus is the long bone that extends from the shoulder to the elbow. Which skeletal system does the humerus belong to?
    10·2 answers
  • All individuals have two alleles for a given trait. According to Mendel's ____________, these alleles are passed down one each f
    10·2 answers
  • Malaria parasite reproduces inside the
    6·2 answers
  • What needs to happen for the ocean to move into land
    12·1 answer
  • Uestio
    6·1 answer
  • Which statements about electromagnetic waves are true?
    14·2 answers
  • 100 Points And Brainly If you answer correctly with detail.
    5·1 answer
  • A group of students is measuring the number of paper bags that are brought to a recycling center in a single day.
    5·2 answers
  • Money that mining companies may be required to post in order to begina mining project
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!