The correct answer is:
1 - Blue wildebeest (Connochaetes taurinus)
2 - Blue wildebeests
3 - Blue wildebeests and Black wildebeests
4 - Blue wildebeests, Black wildebeests, crocodiles, acacia trees
5 - Maasai Mara
A hierarchical organization is an organizational structure where every component of the organization is subordinate to some other component.
Resource partitioning
Resource partitioning refers to differences in resource use
between species regardless of the origin of the differences. Similar species
can coexist in the same ecological community without one pushing the others to
extinction through competition. Species compete for the same resources which
include nutrients and habitats which are the raw materials needed by organisms
to grow, live, and reproduce. For the question given above, the divergence in
lizards is an example of resource partitioning.
1. Water is abioitic and is needed by every living organism Soil is abioitic and is needed by plants Trees and other plants release water vapor from their leaves (a process called transpiration) that create humidity (which in turn influences how much rain falls in an area) The climate in an area influences the special adaptations that plants and animals have. For example: warm fur coats and thick layers of fat to keep warm in cold climates, animals in dry, hot climates (desert) have large ears to release heat and cool down. Biotic factors also influence abiotic factors. Animals produce waste (go to the bathroom) which in turn will become nutrients in the soil.
2. decrease heat will affect biotic factors, like animals, warmth.
Hope this helped :)
Answer:
The observable traits expressed by an organism are referred to
EXPLANATION:
An organism's underlying genetic makeup, consisting of both physically visible and non-expressed alleles, is called its genotype. Mendel's hybridization experiments demonstrate the difference between phenotype and genotype.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
