1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kykrilka [37]
3 years ago
10

Which one of the following is not an example of a type IV hypersensitivity?

Biology
1 answer:
REY [17]3 years ago
3 0

Answer:

Option (4).

Explanation:

Hypersensitivity may be defined as the hyper immune response of the body. Hypersensitive is also known as hyper sensitive reaction that may be uncomfortable and harmful for the individual.

Type IV hypersensitive reaction is also known as delayed type of hypersensitivity that are generally mediated by T cells. Hemolytic disease of new born is an example of Type II hypersensitive reaction and not related to Type IV hypersensitive reaction.

Thus, the correct answer is option (4).

You might be interested in
What is the powerhouse of the cell?
dangina [55]
Mitochondria is the powerhouse of a cell
8 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
What is the geologic column?
Svetllana [295]
The answer should be A
5 0
3 years ago
Read 2 more answers
Sir isaac newton was sitting under an apple tree when an apple tree on his head. Was the force acting on the apple doing so dire
madreJ [45]

Answer:

A. At A Distance

Explanation:

4 0
3 years ago
Which of these is the correct method to test the odor of an unknown chemical?
babunello [35]
Hi.

After a quick search, I'm pretty positive you're supposed to use the wafting technique.<em>


</em>
<em />Hope this helps.<em>
</em>
7 0
3 years ago
Other questions:
  • True or false Sepals are found at the tops of the stamen.
    10·2 answers
  • Biologists have discovered ways ________ can reduce the symptoms of diseases. weather diet energy water
    15·2 answers
  • Which of these parts of the membrane help large moecules pass through it ?​
    5·1 answer
  • Agile methods in science engineering take which of the following approaches towards creating solutions?
    13·2 answers
  • Are the terms tectonic plates and plate tectonic the same?
    14·1 answer
  • Helpp please ASAP ! I will mark Brainliest !!
    5·1 answer
  • Se efectúa un experimento en el que a la planta 1 se le suministra CO2 normal pero agua que contiene átomos de oxígeno radiactiv
    15·1 answer
  • List 6 characteristic of life?
    6·1 answer
  • Question
    10·1 answer
  • What event at letter b leads to elongation of the bone?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!