1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SVETLANKA909090 [29]
4 years ago
5

Charles Darwin spent over 20 years developing his theory of natural selection. True or false?

Biology
1 answer:
Oksanka [162]4 years ago
7 0
This is true, Darwin spent over 20 years developing his theory of natural selection
You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
4 years ago
A male bison charging another male bison is an illustration of which behavior?.
alukav5142 [94]

Bison are big mammals that belong to the family Bovidae. Male bison charging each other shows the competition among organisms of the same species.

<h3>What is the competition?</h3>

Competition is the ecological relationship between the organism of the ecosystem that can be positive, neutral or negative. It can be between species or among the member of the species.

Two bison fighting each other shows the competitive relationship between both of them as they both belong to the same species and can fight for territory, food, resources, reproduction and many others factors.

Therefore, the Bison charging shows competitive relationships among the same species.

Learn more about the competition here:

brainly.com/question/1872222

8 0
3 years ago
The epidermis is made of :
denis23 [38]
Epidermis is made up of dermis.
8 0
3 years ago
Which absorption rate of minerals is faster plant foods or animal foods?
kiruha [24]
Overall, minerals from animal products are better absorbed than those from plant because binders such as fiber are not present to hinder absorption.
7 0
3 years ago
Question 1:
SpyIntel [72]

Hello. You forgot to enter the necessary data for this question to be answered. The data are shown in the figure attached below:

Answer:

Red-capped Robin is the group of Robins that share a more recent common ancestor with the Norfolk Island robins.

Explanation:

Red-capped Robin is the group of Robins that share a more recent common ancestor with the Norfolk Island robins, this can be seen by the degree of genetic similarity between these two species, since the Red-capped Robin has 98.2% of genetic similarity .

When two species have the same common ancestor, these species have great genetic similarity and the more recent this ancestry is, the greater the genetic similarity between the species.

3 0
3 years ago
Other questions:
  • A week after a near-drowning incident, a 6-year-old boy presents with respiratory distress, tachypnea, and fever. What should yo
    5·1 answer
  • During intense (heavy) exercise, the ability of oxidative phosphorylation to provide enough ATP for force generation by the skel
    7·1 answer
  • Plz help it’s # 43. Very important need this very fast
    5·2 answers
  • This is found in cell membranes and help protect the cell or organelles by allowing/not allowing molecules to enter. What is it?
    9·2 answers
  • Which of the following has kinetic energy?<br> A. light<br> B. motion<br> C .food<br> D. motion
    13·1 answer
  • Identify at least two food chains represented in the food web below.
    13·2 answers
  • What are alleles?
    9·1 answer
  • An ideal frictionless machine: O has very little friction O has no friction does not require work input PLEASE HELPP MEEE ​
    9·2 answers
  • The contractile organelle of skeletal muscle fibers is
    6·1 answer
  • In an ocean ecosystem, which is necessary to begin a food web?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!