1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anvisha [2.4K]
3 years ago
7

What does the plasma membrane do?

Biology
2 answers:
sergeinik [125]3 years ago
6 0

Answer:

The plasma membrane is selectively permeable and regulates rreerere

Answer up there

Hoochie [10]3 years ago
4 0

Answer:

The plasma membrane protects cells from its surroundings.

Explanation:

You might be interested in
) what, historically, have been apple's competitive advantages?
Iteru [2.4K]
Competitive advantages of apple were; 
Apple preferred Horizontal and vertical integration around its products instead of licensing it or making it open market or sharing the technology.
Easy to use- they focused on ease of operation and simple user interface.
Facility of plug and play so that non-technical users do not face any issues.
Uniqueness and innovation in enhancing consumer's digital life for example- Digital Hub- an advantage for consumers who were becoming entrenched in a digital lifestyle, using digital cameras, portable music players and digital camcorders and mobile phones.
Investment in R&D brought the key competitive advantage to apple.
8 0
3 years ago
What would an organism need to do to release energy
AleksandrR [38]

Answer:

with the help of liposite

6 0
3 years ago
A clownfish and a sea anemone what relationship is this ?
Alexxandr [17]

Clownfish have a "symbiotic" relationship with sea anemone. Meaning they benefit from living with the sea anemone, and the sea anemone benefits from the presence of the clownfish.

6 0
3 years ago
Read 2 more answers
What does a food web show?
Zigmanuir [339]
B. the complex interactions
and feeding relationships
between organisms within
an ecosystem
5 0
2 years ago
Read 2 more answers
The chemical reaction Na+ + Cl- NaCl is best described as a(n) _____.
Harrizon [31]
Sorry it would not let me nothing else
3 0
3 years ago
Other questions:
  • An aponeurosis is​ a: A. ​cord-like structure that attaches the end of a muscle to a bone. B. sheet of connective tissue that at
    7·1 answer
  • The _____ theory of dreaming proposes that dreaming occurs when the cerebral cortex synthesizes neural signals generated from ac
    10·1 answer
  • Which qualities describe the entire open-ocean zone? Check all that apply. few nutrients
    14·2 answers
  • Which best describes the process that the pest population has experienced due to this environmental change?
    12·1 answer
  • The atomic mas of an element whose atoms consist of eight protons,nine neutrons and eight electrons is
    9·1 answer
  • Which cell organelles are most closely associated with energy changes in a plant? 1. Mitochondria and Chromosomes 2. Chloroplast
    14·1 answer
  • Gene genealogies can vary for different loci. What does this imply for species trees? Group of answer choices
    9·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Representation of system or object such as charts or maps are
    11·2 answers
  • Will a lunar eclipse be visible from every place on Earth that is facing the moon? Explain the reasoning behind your answer.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!