1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Jet001 [13]
3 years ago
9

Give an example of how a biome is an open system from the point of view of the biosphere, atmosphere, lithosphere, and hydrosphe

re.
Biology
1 answer:
Karolina [17]3 years ago
7 0

Given what we know, we can confirm that the biome is in fact an open system due to the interactions between the biosphere, atmosphere, lithosphere, and hydrosphere.

<h3>What is the biome?</h3>
  • The biome is the collection of air, soil, water, and all the organisms that reside within these ecosystems.
  • In order to describe an open system, we say that the system must have external interactions.
  • A biome is an open system because it has both internal and external interactions, such as with asteroids in space.
  • The internal interactions include the ones between the<em><u> biosphere, atmosphere, lithosphere, and hydrosphere.</u></em>
  • A prime example is the movement of water through each of the spheres.

Therefore, since each part of the biome interacts with each other as well as with external sources such as space, we can confirm that it complies with the definition of an open system.

To learn more about open systems visit:

brainly.com/question/8987993?referrer=searchResults

You might be interested in
Who does water pollution affect?
Zepler [3.9K]

Answer:

B. only the animals living in water

4 0
2 years ago
Read 2 more answers
What is the complementary DNA strand to the DNA sequence shown below? <br><br> AACACTTAT
8090 [49]
TTGTGAATA here ya go
6 0
2 years ago
Which phase of mitosis is shown in the diagram
Lorico [155]

If there's this picture in the question, the right answer is metaphase.

A metaphase qualifies a phase of meiosis or mitosis (following prophase and preceding anaphase) during which chromosomes, or at least kinetochores, align with the equatorial plate of the spindle. At this stage, chromosomes are at their maximum condensation and karyotypes are usually established. In the first division of meiosis, the metaphase represents the phase during which meiotic analysis is usually accomplished.


3 0
3 years ago
Read 2 more answers
Which statements can be supported by using a position-time graph? Check all that apply? A negative slope results when an individ
kiruha [24]
2, 3, 5 i belive so that the ansewr 
4 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • What is the name of the scientific method has an independent variable, dependent variable, constants, and control group?
    11·1 answer
  • In the africa savanna mor widebeasts are born than the enviroment
    9·1 answer
  • Explain why it is important to put a lid on the Petri Dush​
    11·1 answer
  • (20 POINTS + BRAINLIEST) What polysaccharide provides rigidity and strength in plants?
    14·2 answers
  • In cold temperatures, phospholipid bilayers with saturated fatty acid tails are more rigid, while phospholipid bilayers with uns
    9·1 answer
  • What are the differences between dandelions and grass?
    10·1 answer
  • describe the interaction between the Farmer and Manufacturing objects, such as farming equipment. How does energy flow
    11·1 answer
  • What are unicellular prokaryotes that live in dust?
    5·1 answer
  • 2. The ______________ is a semipermeable membrane that forms a boundary between the cell and the external environment.
    14·2 answers
  • In response to a state of shock, what mechanisms does the sympathetic nervous system utilize in the four distinct stages to help
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!