Answer:
True.
Explanation:
Therapeutic cloning is the technique of using cloning procedures to generate embryonic stem cells that can be applied for the damaged organ or tissue replacement without getting the chances of any rejection. This can be achieved by putting a diploid nucleus from a body cell to a enucleated cell. Then from that cell an identical organ can be developed.
Answer:
I think it's to protect and distribute the zygote.
Your answer will be NEANDERTHAL
hope it helps ^_^
<h3>♫ - - - - - - - - - - - - - - - ~Hello There!~ - - - - - - - - - - - - - - - ♫</h3>
➷ The endocrine system is an organ system that works to produce and secrete hormones. It works by producing and secreting hormones that serve many purposes in the human body. For example, the secretion of insulin helps to regulate the level of glucose in the blood.
<h3><u>✽</u></h3>
➶ Hope This Helps You!
➶ Good Luck (:
➶ Have A Great Day ^-^
↬ ʜᴀɴɴᴀʜ ♡
Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
