1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irinina [24]
3 years ago
10

Both flatworms and roundworms have a body type called _____.

Biology
2 answers:
lesantik [10]3 years ago
7 0
I believe that both flatworms and roundworms have a body type called Bilateral symmetry.  Animals that are bilaterally symmetric have mirror symmetry in the sagittal plane, which divides the body vertically into left and right halves, with one of each sense organ and limb pair on either side. 
goldenfox [79]3 years ago
4 0

Answer:

Bilateral symmetry

You might be interested in
the amount of energy released and the amplitude of seismic waves are measured by the scale known as *NEED ANSWER NOW*
Paul [167]
The scale used is the Richter scale.

Hope it helped!
4 0
3 years ago
How would you classify corals' role in its community (keystone, dominant, foundation, pioneer, Indicator, or more than one) and
kogti [31]

Answer: Keystone species

Explanation: A keystone species is a species which occupied a niche so central in the ecosystem that it has a disproportionately large effect on its environment and other species in it.

The coral's function in its ecosystem is so vital that if you were to remove it, the entire community would be drastically altered beyond recognition.

The coral serves as the base structure of its ecosystem.

That is to say that many corals are hermatypic(they form reefs). This reef serves as the environmental structure of the Coral's ecosystem. Built in and around it is a very biodiverse biotic environment. The coral not only serves as a hiding place and habitat for many marine organisms including fish, clams, lobsters, etc. It serves as resting place for larger animals like turtles and also serves as hunting sites for other animal species.

The most common way of determining a keystone species, is to see what happens when that species is removed from the ecosystem. Coral have shown to be so central to their ecosystem that the bleaching of coral reefs due to tourism and climate change causes a massive loss to biodiversity. And this is quite significant as reefs are the most biodiverse marine habitats.

6 0
3 years ago
Can a protagonist be a villain
larisa [96]
I think a villain can be a protagonist because the hero is antagonist.
8 0
3 years ago
Read 2 more answers
Genotypes are said to be in ___________ equilibrium if there is random mating and no other forces tend to alter the proportions
harina [27]

Answer: Hardy Weinberg

Explanation:

Genotype of the person are the characters that are can be defined as the genes that is responsible for certain traits.

Hardy Weinberg Rule states that if there is a random mating in the population then the genotype and allele frequencies in a population will remain constant from generations to generation in the absence of the evolutionary forces.

Hence, the correct answer is Hardy Weinberg.

5 0
3 years ago
An enzyme is used as aln)
Novay_Z [31]

I'd say protein synthesizer.

5 0
3 years ago
Read 2 more answers
Other questions:
  • What type of enzyme in the replisome catalyzes addition of nucleotides to the growing dna strands?
    8·1 answer
  • some bacteria are decomposers, which fill an important role in the food web. What would happen to an ecosystem without decompose
    14·2 answers
  • Describe genetic diversity
    13·1 answer
  • Where does the energy come from to power the addition of a high-energy phosphate group to an adp molecule by atp synthase in the
    10·1 answer
  • Which of the following describes a possible effect that an increase in carbon dioxide in the atmosphere would have on an ecosyst
    14·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Question 11 (1 point)
    10·1 answer
  • Match the following enzymes involved in DNA replication with their functions.
    12·1 answer
  • Female sheep have egg cells with 26 chromosomes. How many chromosomes are in each cell of an adult sheep?
    14·1 answer
  • Fill in the blanks
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!