1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kotegsom [21]
3 years ago
6

The rate of firing of the postsynaptic neuron depends on the amount of ______ input it receives from the presynaptic neuron.

Biology
1 answer:
DIA [1.3K]3 years ago
6 0

The correct answer is d. both excitation and inhibition.

There is a process which is called summation and it refers to the process that determines whether or not an action potential (on postsynaptic neuron) will be generated by the combined effects of excitatory and inhibitory signals (from the presynaptic neurons). Depending on the sum total of inputs, summation may or may not reach the threshold voltage to trigger an action potential (firing of postsynaptic potential).


You might be interested in
Please join <br>but enjoy bugjdztozy​
s2008m [1.1K]

Answer:

h

Explanation:

7 0
3 years ago
4. For the picture can you answer 3 or 4 please Based on your knowledge about prokaryotic cells and
Lelu [443]

Answer:

For number 3:

The bacterial cell is a prokaryotic cell and the fungal cell is a eukaryotic cell.

Explanation:

I cannot see the cells to answer number 4, but for number three, bacteria is a prokaryote and fungal cells are eukaryotes. You can most likely determine this by the presence of a nucleus (a prokaryote cell will not have one where a eukaryotic cell will).

3 0
2 years ago
If you are startled by the sound of a loud explosion, the _______________ nervous system will become dominant.
harkovskaia [24]
If you are startled by the sound of a loud explosion, the sympathetic nervous system will become dominant. The sympathetic nervous system is responsible for regulating not only the functioning of the visceral organs (kidneys, digestive system and circulatory system) but also all the automatic functions of the organism, such as breathing, circulation, digestion and elimination. 
5 0
3 years ago
Which chemical components may be parts of a molecule of transfer RNA?
Nastasia [14]
I think the answer is B but I could be wronged
7 0
3 years ago
Read 2 more answers
g the period of time that begins with contraction of the atria and ends with ventricular relaxation is known as: question 36 opt
Archy [21]

The period of time that begins with the contraction of the atria and ends with ventricular relaxation is known as the Cardiac cycle.

<h3>What is a cardiac cycle?</h3>

The cardiac cycle describes a whole heartbeat from its onset to the beginning of the following pulse. It consists of the diastole, systole, and the interval in between. Heart rate, which is naturally expressed as beats per minute, serves as an example of how a cardiac cycle occurs.

<h3>Cardiac Cycle Physiology</h3>

The left and right halves of the human heart's four chambers make up the body. The right and left ventricles are located in the lower two chambers, while the left and right atria are located in the two top chambers. Pumping deoxygenated blood to the lungs through the pulmonary arteries and the pulmonary trunk is the right ventricle's main job. While the left ventricle is in charge of pushing freshly oxygenated blood to the body through the aorta.

Learn more about deoxygenated blood here:-

brainly.com/question/13162823

#SPJ4

6 0
1 year ago
Other questions:
  • Part f - electron transport chain and chemiosmosis in this activity, you will be asked to examine the illustration above and det
    14·1 answer
  • Why do biologists assign each organisms a universally accepted name?
    11·2 answers
  • You find a fossil in your backyard. Twelve percent of the Carbon 14 isotope is remaining. How old is the fossil?
    15·1 answer
  • Please help me with my questions
    11·2 answers
  • The organic chemicals that help cell membranes to conserve internal fluids are:
    9·1 answer
  • There are two different alleles for flower color, P and p. The image shows a purple sweet pea that is labeled with its two allel
    13·2 answers
  • The human GM-CSF gene and the mouse GM-CSF gene vary by more than 60% in their DNA sequence. However, when scientists place the
    8·2 answers
  • The geological time scale represents the history of what?
    12·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • What process uses analysis of the decay of atomic particles to determine exact age?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!