Answer:
Condensation problems are most likely to occur in climates where temperatures frequently dip to 35°F or colder over an extended period of time.
Explanation:
Answer:
Chemical weathering
Explanation:
Caves are formed by the dissolution of limestone. Rainwater picks up carbon dioxide from the air and as it percolates through the soil, which turns into a weak acid. This slowly dissolves out the limestone along the joints, bedding planes and fractures, some of which become enlarged enough to form caves.
Chemical weathering involves the decomposition of rocks due to chemical reactions between minerals such as calcite with water and gases in the atmosphere (e.g. carbon dioxide and sulphur dioxide). The solution of soluble minerals is particularly important in limestone landscapes.
Solutional caves or karst caves are the most frequently occurring caves. Such caves form in rock that is soluble; most occur in limestone, but they can also form in other rocks including chalk, dolomite, marble, salt, and gypsum.
Essentially, water reacts with carbon-dioxide to form carbonic acid. It then seeps slowly through the roof of the cave, depositing calcium carbonate, which hardens and builds up over time to form a stalactite.
Positive selection tests to see if the TCR of a T-lymphocyte can recognize and bind to an MHC molecule.
<h3>What is a T-lymphocyte?</h3>
A T-lymphocyte is a special type of immune cell that is generated inside the bone marrow.
The T-cell receptor (abbreviated as TCR) is a protein located on these immune T lymphocytes.
In conclusion, Positive selection identifies if the TCR of a T-lymphocyte can recognize and bind to an MHC molecule.
Learn more about T-lymphocytes here:
brainly.com/question/17025187
#SPJ1
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Protein microarrays, an emerging class of proteomic technologies, are fast becoming critical tools in biochemistry and molecular biology. Two classes of protein microarray are currently available: analytical and functional protein microarrays. Analytical protein microarrays, most antibody microarrays, have become one of the most powerful multiplexed detection technologies. Functional protein microarrays are being increasingly applied to many areas of biological discovery, including studies of protein interaction, biochemical activity, and immune responses. Great progress has been achieved in both classes of protein microarrays in terms of sensitivity, specificity, and expanded application.
