<span>1. Which of the following is an ABIOTIC factor?
C. Rocks
2. What is an input of photosynthesis AND flows through the Carbon Cycle? *
B. Carbon Dioxide
3. Where is/can carbon be stored for long periods of time (longer than a lifetime)? *
A. In rocks
4. Where is carbon found?
D. All of the above
5. How are cellular respiration and photosynthesis related to the carbon cycle? (no multiple choice it's a written answer)
</span>in order to live, people and animals inhale oxygen and give out carbon dioxide. Carbon dioxide is taken by plants in a process called photosynthesis and it is used in the presence of <span>energy from sunlight to produce carbohydrates and oxygen. </span>
Explanation:
The role of alcohol in DNA extraction is to precipitate DNA into a visible form. Also, it's used in DNA washing and storing
<span>C) use of spores instead of seeds</span>
Answer:
Although people living in low latitudes have high levels of eumelanin, this pigment can be found in people around the world (because it is predominant in people with brunette hair)
Explanation:
In animals and humans, melanin pigments play key roles in eye, hair, and skin coloration. Basically, there are three main types of melanin pigments: eumelanin (brown-black and insoluble), pheomelanin (yellow-red and soluble in alkali solution) and neuromelanin (found in some parts of the brain). Eumelanin is predominant in black people and brunette hair people, this being consequently found around the world. There are two distinct classes of eumelanin: black eumelanin and brown eumelanin, which differ in their patterns of polymeric bonds, and they have an incidence on the type of coloration (e.g., black eumelanin is found in people with grey hair).
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
