1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gregori [183]
3 years ago
5

How are cyclotrons used to create synthetic elements?

Biology
1 answer:
Kipish [7]3 years ago
6 0
Cyclotrons is used to speed up or accelerate creation of synthetic elements. Cyclotrons are also called Particle accelerator which causes the elements to speed up and collide, and fuse with another element called atomic nuclei to produce synthesized or synthetic elements.
You might be interested in
Which of these statements describes some aspect of facilitated diffusion?a.Facilitated diffusion is another name for osmosis.b.F
frosja888 [35]

Answer:

D

Explanation:

Facilitated diffusion is a form of passive transport hence no energy is required by the cell. This means that while the molecules are moving down a concentration gradient – line normal diffusion – the movement of the molecules needs to be facilitated (in this case by a transmembrane protein) either because the molecule is polar and can't pass through the hydrophobic region of the cell membrane, or the molecule is too big to passively pass through the small natural pores of the cell membrane.

5 0
3 years ago
A self-assessment identifies your skills and interests for the purpose of______planning
kherson [118]
Try using your on opinion and see what you can come up with and good luck
5 0
3 years ago
What is biogeography and what does it provide?
Dennis_Churaev [7]
Biogeography- it is the geographic location and distribution of living organisms.
It provide evolution in many ways because organisms are not distributed evenly throughout the world, but related organisms are found in the same isolated parts of the world and this is not explained by climate.


3 0
3 years ago
Small rocks that have been broken down by weathering and erosion are called.
Lilit [14]

Answer: Sediment. Hope this helps :^)

4 0
2 years ago
what is a good hypothesis for, how does heart rate change during and after an exercise is performed for two different periods of
Mila [183]
As you workout your heart rate will increase because you need oxygen.
3 0
3 years ago
Other questions:
  • Which of the following does not accurately describe the forces that exist with an atom?
    9·2 answers
  • What happens to the amount of oxygen in a diver's bloodstream when he or she breathes oxygen at elevated pressures?
    13·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Booker has a really bad headache, so he takes a new painkiller. the drug works wonderfully to relieve his headache. the next tim
    14·2 answers
  • Please answer asap!<br><br> what were the two factors that caused differences in wind speed?
    5·1 answer
  • if the secondary consumers is one of the food chains used 4200 kcal, what amount of energy was absorbed by the producers?
    10·1 answer
  • In pasteur's investigation, how did he make his test fair?
    9·1 answer
  • Each of the enzymes of the pyruvate dehydrogenase complex requires a different vitamin. True or False
    7·1 answer
  • Which of these levels of organization includes all the other levels? ecosystem, community, individual organisms, population
    5·1 answer
  • Why are land resources beneficial?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!