1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frutty [35]
3 years ago
15

What kinds of foods are high in lipids?

Biology
2 answers:
kramer3 years ago
6 0

Answer:

Butter and lard.

Explanation:

Lipids are organic substances, made up of fatty acids or derivatives of fatty acids. Examples of lipids include steroids, natural oils, and waxes. Lipids are soluble in various organic solvents, but insoluble in water.  

Food substances rich in lipid are vegetable oil, lard (fat from pig), butter, cheese, meat and other tropical oils.

Thus, the correct answer is option). butter and lard.

Scrat [10]3 years ago
5 0
Butter and lard are high in lipids.
You might be interested in
In an enzyme-substrate reaction, what does Vmax refer to?
Varvara68 [4.7K]
A it refers to the speed of the conversion to substrate
7 0
3 years ago
Read 2 more answers
What are the two main components of the nervous system? A. the brain nervous system and the spinal cord nervous system B. the pa
ANTONII [103]

Answer: The correct answer is  D. the central nervous system and the peripheral nervous system.

The nervous system is a complex system that is made up of nerves and nerve centers in different organisms that carries messages to and from the brain and the spinal cord to send them into various parts of the body.

It is primarily divided into-

1) CNS that is central nervous system ( made up of brain and spinal cord). The CNS is responsible for the voluntary functions of the body.

2) PNS that is peripheral nervous system ( possess cranial and spinal nerves arising from brain and spinal cord respectively). It controls the involuntary functions of the body.



7 0
3 years ago
Read 2 more answers
2) Why do you think certain colors, types, makes or models are more popular than others?
NNADVOKAT [17]
I ink what the other person said
3 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Which term describes baody parts of different organisms that are similar in form
uranmaximum [27]

Homologous structures (Not to be confused with Homologous pairs)

7 0
3 years ago
Other questions:
  • What sre the proportions of clay, silt, and sand shown at point B in figure 5-1
    13·1 answer
  • Which of the following plant systems is most like the cardiovascular system in animals?
    10·2 answers
  • What energy storing molecule(s) are produced by the Krebs Cycle that go to the Electron Transport Chain?
    8·2 answers
  • If the concentration of hydrogen ions (H+) outside the thylakoids were equal to the concentration of H+ inside the thylakoids, h
    12·2 answers
  • Biotin and protien do what for the hair
    11·1 answer
  • *PLEASE HALPPPPPPPPP**PLEASE HELP SUPER URGENT FOR BRAINLIEST* A physical property that depends on the amount of matter in the s
    8·2 answers
  • What kinds of bonds can form between two adjacent water molecules
    12·1 answer
  • What would happen if our atmosphere consisted of pure oxygen
    15·1 answer
  • What part of the cell separates and takes up positions on opposite sides of the nucleus during?
    13·1 answer
  • Which is the correct order of events for fossil formation?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!