1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BaLLatris [955]
3 years ago
13

If you look at a cyan colored ribbon under white light . What three primary colors is your eye not detecting ?

Biology
1 answer:
Vlada [557]3 years ago
5 0

Answer:

Red

Explanation:

Cyan is a color that is formed from then combination of green and blue light. It is a greenish-blue color. It has a predominant wavelength of between 490–520 nm and wavelengths of between green and blue.

Primary colors consists of red, blue and green.

When Cyan is placed under white light, it doesn’t detect the primary color red. It only detects blue and green.

You might be interested in
How many total atoms are in the following compound?<br><br> 2K2CO3
frutty [35]

Answer:

There is 3 because K2 is its own atom and it has 2 K2 and Co3 is its own and there's one

Explanation:

This is what I was taught

7 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Which property of water is most directly responsible for the ability of sweat to lower body temp?
Marina86 [1]
Absorption of heat by breaking down hydrogen bonds
7 0
3 years ago
What part of the female system is the usual site of fertilization of the ovulated oocyte?.
Paul [167]

Fertilization of the egg cell by the sperm usually takes place in the fallopian tube. The fertilized egg then travels to the uterus and implants in the endometrium.

<h3>What are fallopian tubes?</h3>
  • Fallopian tubes are also called oviducts or uterine tubes. It is the passage through which the egg enters the uterine cavity from the ovary.
  • Fallopian tubes are part of the reproductive tract. They have a smooth muscle wall, an inner mucous membrane, and an outer layer of loose supporting tissue (serosa).
<h3>Why does fertilization take place in the fallopian tubes?</h3>

The fallopian tube (oviduct) regulates fertilization through sperm induction and sperm hyperactivity. Sperm induction is achieved by rheotaxis, thermotaxis, and chemotaxis. Rheotaxis is caused by tubal fluid that creates a current flow from the tubal ampulla to the tubal isthmus.

To learn more about fallopian tubes visit:

brainly.com/question/12711470

#SPJ1

8 0
1 year ago
How do the size of each population affect each other
enyata [817]

Answer:

economic and everything

Explanation:

If one population dies out, all the populations that depend on that species for food may also die out. A change in one population affects the entire community because all the populations of a community depend on each other. ... A population is all the members of one type of organism living in an ecosystem.

As a population grows in an area, a population may experience the effects of increased densities. In a given area, is the maximum population size of the species that the environment can sustain is called the carrying capacity. Carrying capacity is determined by the amount of available resources (food, habitat, water).

4 0
3 years ago
Other questions:
  • What function group pairing allows amino acids to bond together to form polypeptides?
    8·1 answer
  • Some rivers no longer reach the ocean because
    6·1 answer
  • Organisms that cannot photosynthesize and must get their energy by eating other organisms are called
    13·1 answer
  • In the snail cepaea nemoralis, an autosomal allele causing a banded shell, u, is recessive to the allele for an unbanded shell,
    10·1 answer
  • PLEASE HELP ASAP I DONT KNOW THIS. My teacher neverrrrr went over this
    15·1 answer
  • A. All living things are made out of cells B. Cells are the smallest unit of life C. All cells have a nucleus and chloroplasts D
    14·2 answers
  • How could i get a 79 &amp; all the answer i had was from here
    5·2 answers
  • PLEASE HELPPPPPPPPPPPP
    9·1 answer
  • Which is the correct associaticm?: polymers combine to form monomers glucose combines to form proteins FIRST ਜ monomers combine
    13·1 answer
  • The nitrogen cycle could not exist without?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!